Skip to main content

Table 2 Pancreas enriched miRNAs conserved between rat and dog

From: The Rat microRNA body atlas; Evaluation of the microRNA content of rat organs through deep sequencing and characterization of pancreas enriched miRNAs as biomarkers of pancreatic toxicity in the rat and dog

Rat pancreas Sequence (5′-3′) Dog Pancreas Sequence (5′-3′)
miR-101c TACAGTACTGTGATAACTGATC miR-101c ACAGTACTGTGATAACTGACC
miR-141-3p TAACACTGTCTGGTAAAGATG miR-141 TAACACTGTCTGGTAAAGATG
miR-193b-3p AACTGGCCCACAAAGTCCCGCT miR-193a-3p AACTGGCCTACAAAGTCCCAGTT
miR-200c-3p TAATACTGCCGGGTAATGATGGA miR-200c TAATACTGCCGGGTAATGATGGA
miR-216a-5p TAATCTCAGCTGGCAACTGTG miR-216a TAATCTCAGCTGGCAACTGTGA
miR-216b-5p AAATCTCTGCAGGCAAATGTGA miR-216b AAATCTCTGCAGGCAAATGTGA
miR-320-3p AAAAGCTGGGTTGAGAGGGCGA miR-320b;miR-320c AAAAGCTGGGTTGAGAGGGAA
miR-4286 ACCCCACTCCTGGTACCA miR-4286 ACCCCACTCCTGGTACCA
miR-5100 ATCCCAGCGGTGCCTCCA miR-5100 GTTCGAATCCCAGCGGTG
miR-217-5p TACTGCATCAGGAACTGACTGGA miR-217 ATACTGCATCAGGAACTGATT
miR-375 TTTGTTCGTTCGGCTCGCGTGA miR-375 TTTGTTCGTTCGGCTCGCGTGA
  1. Tissue enriched miRNAs conserved between rat and dog were identified and are shown above. These miRNAs were analyzed for changes in the serum in rat and dog caerulein toxicology studies. Bases underlined indicate bases that are not conserved between the rat and dog isomiRs with the highest sequencing counts