Skip to main content

Table 3 qPCR primer sequences and characteristics

From: Microarray based gene expression analysis of Sus Scrofa duodenum exposed to zearalenone: significance to human health

Gene Accesion no. Primer source Primer sequence (5′ → 3′) Orientation Tm (°C) Amplicon lenght (bp) References
TNF-α NM_214022 Pig ACTGCACTTCGAGGTTATCGG forward 60 118 [54]
GGCGACGGGCTTATCTGA reverse 60
IL-8 NM_213867.1 Pig GCTCTCTGTGAGGCTGCAGTTC forward 58 79 [54]
AAGGTGTGGAATGCGTATTTATGC reverse 54
IL-6 NM_214399 Pig GGCAAAAGGGAAAGAATCCAG forward 57 87 [54]
CGTTCTGTGACTGCAGCTTATCC reverse 61
IL-1β NM_214055 Pig ATGCTGAAGGCTCTCCACCTC forward 62 89 [55]
TTGTTGCTATCATCTCCTTGCAC reverse 59
IL-10 NM_214041.1 Pig GGCCCAGTGAAGAGTTTCTTTC forward 54 51 [54]
CAACAAGTCGCCCATCTGGT reverse 55
NFkB1 NM_001048232.1 Pig TCGCTGCCAAAGAAGGACAT forward 54 101 [55]
AGCGTTCAGACCTTCACCGT   
GAPDH NM_001206359.1 Pig ACTCACTCTTCTACCTTTGATGCT forward 49 100 [54]
TGTTGCTGTAGCCAAATTCA reverse 56
B-actina NM_213978.1 Pig GGACTTCGAGCAGGAGATGG forward 60 230 [56]
GCACCGTGTTTGCGTAGAGG reverse 62