Skip to main content

Table 1 Drought responsive precursor miRNAs with their candidate target genes and their expression patterns

From: Transcriptome profiling of drought responsive noncoding RNAs and their target genes in rice

Gene ID aRPKM bLog2 Ratio cMature miRNA/target sequence dPARE sequence PARE libraries
C d1 d2 d3 1d/C 2d/C 3d/C    eA fB gC hD
Inducible miRNAs/targets
 miR-399k 119,291 99,410 1,530,906 3,519,097 −0.26 3.68 4.88 3′-GCCCCGUUUAAAGGAAACCGU-5′      
 Os05g0557700-01 25,889 23,611 8,802 9,104 −0.13 −1.56 −1.51 737-CUGGGCAAAUCUCCUUUGGCA-757 TCCTTTGGCAAAATACCTAT 0 0 1 1
 miR-415 234,165 109,765 160,988 1,529,388 −1.09 −0.54 2.71 3′-GACGAGACGAAGACAAGACAA-5′      
  Os04g0550200-01 9,337 2,36 1,749 273 −1.98 −2.42 −5.10 789-UUACUCUGCUUCUGCUCUGUU-809 CTGCTCTGTTCTCTTTCTTC 0 0 0 1
  Os10g0500500-01 13,806 11,519 7,428 3,613 −0.26 −0.89 −1.93 976-UGCUCUGCAUUUCUUCUGUU-995 TTCTTCTGTTACTCATTCGA 0 2 0 0
 miR-168a 329,822 678,870 1,513,995 981,069 0.11 1.27 0.64 3′-AGGGCUAGACGUGGUUCGCU-5′      
  Os02g0831600-01 5,715 5,283 1,584 687 −0.11 −1.85 −3.06 446-UCCCGAGCUGCGCCAAGCAA-465 CGCCAAGCAATAATGGAAGC 0 0 2 7
  Os03g0687000-02 11,281 10,412 3,293 1,896 −0.12 −1.78 −2.57 1807-UCAUGAUCUGCGCCAAGUGG-1826 CGCCAAGTGGTACAGGTTCA 0 0 0 1
  Os03g0687000-01 9,006 8,713 2,571 1,591 −0.05 −1.81 −2.50 1905-UCAUGAUCUGCGCCAAGUGG-1924 CGCCAAGTGGTACAGGTTCA 0 0 0 1
 miR-821c 27,730 47,537 376,336 364,452 0.78 3.76 3.72 3′-AGUUGAAAAAACAACUACUGAA-5′      
  Os10g0412600-01 14,944 16,110 4,884 334 0.11 −1.61 −5.48 685-UGAACUUUUUUAUUGGUGAUUC-706 TTGGTGATTCCCTCTAATGT 0 0 0 1
 miR-171f-3p 8,297 82,972 107,863 207,429 3.32 3.70 4.64 3′-CUAUAACCGUGCCGAGUUAGU-5′      
  Os09g0555600-01 2,031 1,926 380 60 −0.08 −2.42 −5.07 1488-GGUAUUGGCAUUGCUCAAUUA-1508 TGCTCAATTATGGGCTAAAG 0 0 0 1
 miR-816 150,534 95,795 301,069 136,849 −0.65 1.00 −0.14 3′-CAACAUCAUUUUAUACAGUG-5′      
  Os01g0338100-00 1,722 1,227 701 534 −0.49 −1.30 −1.69 277-AUUGUUGUAGAAUAUGUCAC-296 AATATGTCACTGACCTGGTC 0 0 0 1
 miR-166c-5p 16,860 50,580 25,290 42,150 1.58 0.58 1.32 3′-GAGCCUGGUCUGUUGUAAGG-5′      
  Os03g0823100-01 41,418 36,220 21,357 6,526 −0.19 −0.96 −2.67 784-CUUGGACCAGCCAAUAUUUU-803 CCAATATTTTCCTTCTATTT 0 0 1 1
 miR-166c-3p 16,860 50,580 25,290 42,150 1.58 0.58 1.32 3′-CCCUUACUUCGGACCAGGCU-5′      
  Os12g0612700-01 667 751 573 121 0.17 −0.22 −2.47 874-UGGGAUGAAGCCUGGUCCGG-893 CCTGGTCCGGATTCCATTGG 0 0 53 73
 miR-167g - 25,701 89,953 12,850 - - - 3′-GUCUAGUACGACCGUCGAAGU-5′      
 miR-167b 6,465   19,394 12,929 - - 1.58 1.00 3′-UCUAGUACGACCGUCGAAGU-5′      
  Os06g0129100-01 21,789 14,688 2,477 275 −0.57 −3.14 −6.31 1085-UGUUCAUGCCGGCAGCUUCA-1104 GGCAGCTTCAGGCTCCAGGT 0 0 0 10
  Os07g0481400-01 10,354 8,139 4,789 1,387 −0.35 −1.11 −2.90 2770-UAGAUCAUGCUGACAGCCUCA-2790 GACAGCCTCAAAACAATTGA 0 0 1 6
 miR-159b 11,210 67,260 67,260 - 2.58 2.58 - 3′-GUCUCGAGGGAAGUUAGGUUU-5′      
  Os06g0605600-01 3,381 3,623 4,557 934 0.10 0.43 −1.86 403-UAGAGCUCCCUUCACUCCAAU-423 TCACTCCAATATCCCAACTA 0 3 0 16
  Os03g0683866-00 5,268 5,001 4,429 1,662 −0.07 −0.25 −1.66 1320-UAAAGCUGCCUUCAGUCCAGA-1340 TCAGTCCAGAATATGGGCTT 0 0 0 1
 miR-159f 5,605 11,210 28,025 - 1.00 2.32 - - 3′-AUCUCGAGGGAAGUUAGGUUC-5′      
  Os06g0605600-01 3,381 3,623 4,557 934 0.10 0.43 −1.86 403-UAGAGCUCCCUUCACUCCAAU-423 TCACTCCAATATCCCAACTA 0 3 0 16
 miR-169f - 6,198 43,389 198,351 - - - - - - 3′-AUCCGUUCAGUAGGAACCGAU-5′      
  Os02g0776400-01 1,807 1,507 469, 60 −0.26 −1.94 −4.91 983-UAGGCAAUUCAUCCUUGGCUU-1003 TCCTTGGCTTAAGTTTCATG 6 5 6 66
  Os03g0411100-01 12,413 14,677 4,257 2,061 0.24 −1.54 −2.59 1242-UGGCAAUUCAUCCUUGGCUU-1261 TCCTTGGCTTATGAAGTATC 28 42 37 156
 miR-156i - - 23,416 23,416 - - - - - - 3′-CACGAGUGAGAGAAGACAGU-5′      
  Os06g0663500-00 3,829 3,070 3,323 867 −0.32 −0.20 −2.14 749-GUGCUCUCUCUCUUCUGUCA-768 TCTTCTGTCAGCTAGTTCAA 0 5 1 35
  Os02g0174100-01 2,114 2,279 1,071 564 0.11 −0.98 −1.95 2221-GUGCUCUCUCUCUUCUGUCA-2240 TCTTCTGTCATCTAGTTCTT 0 2 0 11
  Os02g0139400-01 13,403 16,632 13,100 1,392 0.31 −0.03 −3.27 1869-AUGCUCUCUCUCUUCUGUCA-1888 TCTTCTGTCAATCGATTCAG 0 5 25 34
Repressible miRNAs / targets
 miR-530 1,433,087 241,496 231,823 84,299 −1.77 −2.63 −4.09 3′-AUCCACGUCCACGUUUACGU-5′      
  Os04g0603200-01 28,344 24,091 55,324 69,156 −0.23 0.96 1.29 653-CAGAUGAAGGUGCAAAUGCA-672 TGCAAATGCAGGAGCTGTAA 0 0 0 1
  Os03g0296700-02 334 434 534 568 0.38 0.68 0.77 440-UGGAUGCUGGUGCAGAUGCA-459 TGCAGATGCACCGTTCTGAT 0 0 1 0
 miR-399e 169,670 107,160 17,860 8,930 −0.66 −3.25 −4.25 3′-CCCGUUUAGAGG-AAACCGU-5′      
  Os04g0415000-01 5,599 8,625 25,400 18,132 0.62 2.18 1.70 491-GGGCAAUUCUCCGUUUGGCA-510 CCGTTTGGCAGAAGATCAAC 0 0 0 1
 miR-156f 1,501,297 1,370,996 657,172 436,226 −0.13 −1.19 −1.78 3′-CACGAGUGAGAGAAGACAGU-5′      
 miR-156d 1,070,078 1,159,932 1,110,921 130,697 0.12 0.05 −3.03 3′-CACGAGUGAGAGAAGACAGU-5′      
 miR-156g 136,247 364,020 657,790 19,159 0.09 −0.45 −1.91 3′-CACGAGUGAGAGAAGACAGU-5′      
 miR-156j 351,247 364,020 657,790 19,159 0.05 0.91 −4.20 3′-CACGAGUGAGAGAAGACAGU-5′      
  Os01g0922600-01 1,610 2,024 20,929 4,295 0.33 3.70 1.42 620-GUGCUCUCUCUCUUCUGUCA-639 TCTTCTGTCAGACAACCCCA 0 0 2 19
  Os09g0507100-00 42 75 941 950 0.83 4.47 4.49 1034-GUGCUCUCUCUCUUCUGUCA-1053 TCTTCTGTCATCCCCGGCCA 0 0 2 1
 miR-815a 25,391 - 12,696 12,696 - −1.00 −1.00 3′-GGUUAGAGGAGUUAGGGGAA-5′      
 miR-815c 511,525 531,986 225,071 71,613 0.06 −1.18 −2.84 3′-GGUUAGAGGAGUUAGGGGAA-5′      
  Os08g0465800-01 9,970 9,526 61,668 74,744 −0.07 2.63 2.91 1896-CCAAUCUCCUUCCUCCUCUU-1915 TCCTCCTCTTTTTAATCTCT 0 0 0 1
 miR-159a 395,153 360,286 96,851 65,859 −0.13 −2.03 −2.58 3′-UCUCGAGGGAAGUUAGGUUU-5′      
  Os03g0331700-02 7,076 3,394 22,641 50,780 −1.06 1.68 2.84 1513-UGAGUUCCCUUCAUUCCAAA-1532 TCATTCCAAAAGCTTAATTG 0 0 0 1
 miR-393b 151,675 175,623 127,726 31,932 0.21 −0.25 −2.25 3′-UAGUUACGCUAGGGAAACCU-5′      
  Os05g0150500-00 5,537 4,773 20,300 36,796 −0.21 1.87 2.27 1556-GACAAUGCGAUCCCUUUGGA-1575 TCCCTTTGGATGTCGTCGTG 16 18 88 655
 miR-528 227,512 287,384 23,949 - 0.34 −3.25 - 3′-GAGGAGACGUACGGGGAAGGU-5′      
  Os07g0570550-00 290 522 1,334 1,566 0.85 2.20 2.43 180-CUCCUCUGC-UGCCCCUUCCA-199 GCCCCTTCCATGGCGCCCGC 0 0 205 0
 miR-166d 92,729 33,720 84,299 16,860 −1.46 −0.14 −2.46 3′-CCCUUACUUCGGACCAGGCU-5′      
  Os03g0640800-01 1,189 1,224 4,376 8,977 0.04 1.88 2.92 956-UGGGAUGAAGCCUGGUCCGG-975 CCTGGTCCGGATTCCATTGG 0 0 53 73
  Os10g0480200-02 1,638 1,282 2,956 3,158 −0.35 0.85 0.95 922-UGGGAUGAAGCCUGGUCCGG-941 CCTGGTCCGGATTCGTTTGG 0 3 12 179
  1. aRPKM, Reads Per Kilobase of transcript per Million mapped reads; blog2 ratio, log2(drought treatment / control); cbases underlined indicated potential cleavage sites; dPARE sequence matching to cleavage products, starting between base 10 and 11 from the 5′ end of the predicted miRNA pairing; eA (SC938), PARE library of rice wild type seedling degradome, GSM455938 (GEO Accession number); fB (INF939), PARE library of rice wildtype inflorescence degradome, GSM455939; gC (INF9311a), PARE library of rice inflorescence (93-11) wildtype degradome, GSM476257; hD (NPBs), PARE library of rice 3-week-old seedlings wildtype degradome, GSM434596 [29]