Skip to main content

Table 1 Murine RT-PCR primers used for AS event validation in this study

From: The transcriptional and splicing landscape of intestinal organoids undergoing nutrient starvation or endoplasmic reticulum stress

Gene Name Primer Sequences (5’- 3)’
Hnrnpd FW: GAAAGTATCCAGGCGAGGTG
RV: GCTATTAGCAGGTGGCAGGA
Hnrpdl FW: CAGACTACAGCGGTCAGCAG
RV: TGGACCAATACCCCCTACAA
Srsf7 FW: CGCCTTGATTCAGAATGTCA
RV: TGATCTTGACCTCCGTCCTC
Ogt (partial intron 4 retention) FW: ACTGTGTTCGCAGTGACCTG
RV: CAAATCTCCCCTTGTGCATT
Ogt (full intron 4 retention) FW: CTTGGTAGCAGCAGGTGACA
RV: AATGCTCACGGTCTTGCTTT
Slc35b1 FW: AAGGACCCAAACAGGAGACA
RV: ATGGCACCCACATAGGAGAC
Ufd1l FW: TGTTCATTTTATTTCAAAAATCGGAGC
RV: AAGAACTCATCATAGTGCTCCTGC
Ivnsabp1 FW: AGCATCTGGGAGAATGGAGA
RV: CATCATCACTGCCAAACACC
Casp4 FW: TGCTGAACGCAGTGACAAGC
RV: TAAGAGCCTTTCGTGTACGGC
Nnt FW: AACAGTGCAAGGAGGTGGAC
RV: GTGCCAAGGTAAGCCACAAT
Nt5c3 FW: GCTGGCCCAGTACATATTCA
RV: GGGCATCTTTTCCCATTGTA
Frrs1 FW: TTGCATTTCTCACGACCAG
RV: TAGCCTCAGGAAGGGTGATG