Skip to main content

Table 2 CodY binding sites of ChIP-qPCR target genes

From: Changes in Bacillus anthracis CodY regulation under host-specific environmental factor deprived conditions

Target gene CodY binding sitea
BAS0036 AATTTAAAAATTTTTCTGAAAA
BAS1197 ATATCACAATTCAACAATG
BAS1350 ATTGACTAAATTTTCATACAAAACATT
BAS3379 AAAATTAGTAGAATAATAGTTAATAAGAATCTT
BAS3621 CTTAGAAAATTCAGAATGGTAAAATAATATATAAATCGTTGTATGAAAAT
BAS4069 GGAACATACACAGTAAACGATGCGATGTTAGAAGATTTAAAAAATGGTTTTAGTGGTCATCACGCTT
BAS4252 TGAAACTCCCCCTAATAAAAAGTGCCAATATTCCAAA
  1. aThe presented CodY binding sites were identified by Chateau et al. [16]