Skip to main content

Table 2 PCR primers used in this study

From: Transcriptome analysis revealed that a quorum sensing system regulates the transfer of the pAt megaplasmid in Agrobacterium tumefaciens

Targeted gene or region   Primer sequencea
P4 cinI F : GGCGCAATACCTCAATTGATTG
R : CATCATGGACGTCGTATCGATC
P4 pAt non coding-region (coord. 36817–37590b) F : CATCTCGTTGATCGCAACATGGTCGTT
R : GATTTGGATGCTTCAACCGAAGATTTATTTGC
P4 pAt non encoding-region (coord. 36950–37353b) F : CCGAAAGTAACATTTGATGCCCCAACTGAATTTT
R : ATAACTGACAGGCATGCGAAAGCCGTC
P4 cinR cinI cinX F : TGCTTGTCGTCTGCGCCGTGAGA
R : CTCAAACACCGCTGGAGCGAACTCA
P4 avhB5 RT-qPCR F: CCAAGCAGATCGAGAGCAT
R: TTGTTGAGCGAGCCATAAAG
P4 avhB11 RT-qPCR F: ACGCTTTCCAAAGCATTGAT
R: CGTGGTTCGGTTGTGAGATA
P4 AGROTU_05920 RT-qPCR F: TTGTTGAATGTATGCGGGTT
R: TATGCGCTGTGGAGATATGG
P4 traA RT-qPCR F: CGAGCTGTTCCTCACTACAGT
R: TTCAATCTTTCCGACAGCACC
P4 cinR RT-qPCR F: CGTCGGAGAGTTCGGTTATT
R: CCTGCAACAAGTCTGTCCC
P4 cinI (internal) RT-qPCR F: ATATGGGAAGGCACACGAAT
R: AAAGGAACCCAAACGCTCTA
P4 cinX RT-qPCR F: AATATCGGCAGGAGCATTTC
R: GCTCATGCTCAAGGTCAAAG
P4 traG RT-qPCR F: GATTTCGATTCGACCCACAT
R: AGCGGGCCTGTATATCTGAG
P4 gyrB RT-qPCR F: GATGGCAAGGCCTATGAAAC
R: CACTTCCAGAAGATCGGACA
P4 blcR RT-qPCR F: CGACATTCAACGACCATCTC
R: CAGCCGATGTAAACGACTTC
  1. aall primer sequences are given in the 5′- > 3 orientations. F forward primer, R reverse primer
  2. bcoordinates on pAt P4 with respect to the position of the first and last base amplified by the primer couples