Skip to main content

Advertisement

Table 2 Primers sequence used in qRT-PCR experiments

From: The polymyxin B-induced transcriptomic response of a clinical, multidrug-resistant Klebsiella pneumoniae involves multiple regulatory elements and intracellular targets

Primers Sequence Amplicon size Reference
arcB_RT-F 5′ GCTGAACGTCCAACTGAAAG 3′ 157 bp This study
arcB_RT-R 5′ GGAGGATTGCTGTTCGAGC 3′
phoP_RT-F 5′ TGCCGGATGAAGACGGACTA 3′ 226 bp This study
phoP_RT-R 5′ AGGGAGATCACCTGTGAGGC 3′
pmrB_RT-F 5′ GCTGATCCAGCGTCTCGATC 3′ 106 bp This study
pmrB_RT-R 5′ CAACAGCACCTGCTGGTAGC 3′
16S_RT-F 5′ CAGCTCGTGTCGTGAGATGT 3′ 150 bp [66]
16S_RT-R 5′ CGTAAGGGCCATGATGACTT 3′