Skip to main content

Table 1 Primers used in the text

From: Members of WRKY Group III transcription factors are important in TYLCV defense signaling pathway in tomato (Solanum lycopersicum)

Gene Direction Sequence(5'-3') Function
SolyWRKY41 Forward ATGGAGAAAGTTAAAAGTATGGA Full lengths clone
Reverse TTAAATGAAGAATTCTTCAATGTC
SolyWRKY54 Forward ATGGATTGTGGATTCAATTATGAAT Full lengths clone
Reverse TTATCTGAAAAAATCAGAGAAATTTG
SolyWRKY41 Forward CACCATCACCATCACGCCATGATGGAGAAAGTTAAAAGTATGGA Subcellular localization
Reverse CACTAGTACGTCGACCATGGCAATGAAGAATTCTTCAATGTC
SolyWRKY54 Forward CACCATCACCATCACGCCATGATGGATTGTGGATTCAATTATGAAT Subcellular localization
Reverse CACTAGTACGTCGACCATGGCTCTGAAAAAATCAGAGAAATTTG
SolyWRKY41 Forward GTGAGTAAGGTTACCGAATTCGCAACACCAAACCATAACGCTGAA VIGS vector conduction
Reverse GGGACATGCCCGGGCCTCGAGAGGAATTTGAAATCGAAGTCGGAGT
SolyWRKY54 Forward GTGAGTAAGGTTACCGAATTCCCACAGAAACATAAACACAAGAAAC VIGS vector conduction
Reverse GGGACATGCCCGGGCCTCGAGAGGAGAGACAAAAGATGGTGAATAA
SolyWRKY41 Forward GCAACACCAAACCATAACGCTGAA RT-qPCR
Reverse AGGAATTTGAAATCGAAGTCGGAGT
SolyWRKY42 Forward AAGAAACTGTTCCTTTCACTCCACT RT-qPCR
Reverse GAGCTGAACACAATACGATCCGATT
SolyWRKY53 Forward CCACAACCAACATCGCCAGAGAA RT-qPCR
Reverse ACGGTGAATAGCCGCTACCTATCA
SolyWRKY54 Forward CCACAGAAACATAAACACAAGAAAC RT-qPCR
Reverse AGGAGAGACAAAAGATGGTGAATAA
SolyWRKY80 Forward TCACTGTCCAACTTCAAACTCTACT RT-qPCR
Reverse ACGGTCTTGCTTCTCCTTCTTCT
SolyWRKY81 Forward GCAATAGAAGGTTTAATTCGTGGTC RT-qPCR
Reverse GTAGCGACGACGACATCAGA
SolyWRKY41 Forward AGTGACATATAAAGGAAGGCACAGT RT-qPCR for VIGS
Reverse CCCTTCTCCACCAAATGAGGAATT
SolyWRKY54 Forward GCAAGTGCAGAGGTCTGATGATGA RT-qPCR for VIGS
Reverse TGTTGATGAAGTGTTGGCTGAGAAC
TYLCV02 Forward CGCCCGTCTCGAAGGTTC RT-qPCR for VIGS
Reverse GCCATATACAATAACAAGGC
TYLCV01 Forward ATGTCGAAGCGACCAGGCGATATAAT Detection for TYLCV DNA
Reverse TTAATTTGATATTGAATCATAGAAAT
Tubulin Forward TGACGAAGTCAGGACAGGAA Reference gene
Reverse CTGCATCTTCTTTGCCACTG