Skip to main content

Advertisement

Table 1 Seven genomic segments with regulatory activity in Schwann cells

From: Stringent comparative sequence analysis reveals SOX10 as a putative inhibitor of glial cell differentiation

Element ID Locus UCSC coordinatesa SOX10 Consensus sequenceb
SOX10-CCS-01 PAX7 chr1:18,854,300-18,855,055 ACAAACTCATTAAACTTGT
SOX10-CCS-13 SOX6 chr11:16,334,301-16,335,278 ACAATCAAGCATTGT
SOX10-CCS-18 SOX5 chr12:24,058,988-24,059,872 ACAAAAATGTATTGT
SOX10-CCS-19 SOX5 chr12:24,059,397-24,060,164 ACACAGAACATTATTGT
SOX10-CCS-39 TCF7L2 chr10:114,894,980-114,895,808 ACAATCCCCAAGATTTTTGT
SOX10-CCS-43 BCAS3 chr17:56,683,905-56,684,657 ACACATTAATAACGTTTTGT
SOX10-CCS-51 NFIB chr9:14,299,332-14,299,796 ACAATCTGTTCTTTGTGT
  1. aCoordinates refer to the March 2006 UCSC Genome Browser Human assembly (hg18)
  2. bSOX10 consensus sequences are indicated in bold, underlined text