Skip to main content

Table 2 Sex-linked loci, including reference (REF) and SNP allele sequences with SNP positions bolded

From: Sex-linked markers in the North American green frog (Rana clamitans) developed using DArTseq provide early insight into sex chromosome evolution

  Tadpoles Adults
Reference allele homozygous proportion SNP allele homozygous proportion Heterozygous proportion Reference allele homozygous proportion SNP allele homozygous proportion Heterozygous proportion
Locus Allele Sequence Female Male Female Male Female Male Female Male Female Male Female Male
RaclCT001 REF TGCAGCCAACATGTGTTTATGTGCTTTGTTCAGCATG 1.00 0.00 0.00 0.08 0.00 0.92 1.00 0.00 0.00 0.02 0.00 0.98
SNP TGCAGCCAACATGTGTTTATGTACTTTGTTCAGCATG
RaclCT002 REF TGCAGCGAGAACATTTCGGCATG 1.00 0.00 0.00 0.00 0.00 1.00 1.00 0.04 0.00 0.00 0.00 0.96
SNP TGCAGCGAGAACATTTTGGCATG
RaclCT003 REF TGCAGACAGTTGATGACTTCTGCGCACTGTGTCCTTCAGCATG 1.00 0.00 0.00 0.23 0.00 0.77 1.00 0.06 0.00 0.11 0.00 0.83
SNP TGCAGACAGTTGATGACTTTTGCGCACTGTGTCCTTCAGCATG
RaclCT004 REF TGCAGTAGGCATTGGTGATTCATTGATTGTTTTATGCATG 0.92 0.00 0.00 0.00 0.08 1.00 0.96 0.13 0.00 0.02 0.04 0.85
SNP TGCAGTAGGCATTGGTGATTCATTAATTGTTTTATGCATG
RaclCT005*a REF TGCAGACAAACTCATGCTGTGTCTAATCACAGCACAGGTCAGAGTGGGGCATGTGCATG 0.75 0.00 0.00 0.08 0.25 0.92 0.91 0.07 0.00 0.04 0.09 0.89
SNP TGCAGACAAACTCATGCTGTGTCTAATCACAGCACAGGTCAGAGTAGGGCATGTGCATG
RaclCT006a REF TGCAGTGTTATTGCATCATAGGAGCATG 0.92 0.31 0.00 0.00 0.08 0.69 0.91 0.07 0.00 0.04 0.09 0.89
SNP TGCAGTGTTATTGCATTATAGGAGCATG
RaclCT007a REF TGCAGCTCAGTCTCTCCGGCCTCTGTGTGTCCTGTCCTTGACAGCATG 1.00 0.38 0.00 0.00 0.00 0.62 0.96 0.07 0.00 0.13 0.04 0.80
SNP TGCAGCTCAGTATCTCCGGCCTCTGTGTGTCCTGTCCTTGACAGCATG
RaclCT008 REF TGCAGATGAGGATGTACTGGCTTCACTGGCTTCAATTACTGCATG 0.92 0.00 0.00 0.00 0.08 1.00 0.87 0.09 0.00 0.04 0.13 0.87
SNP TGCAGATGAGGATGTACTGGCTTCACTGGCTTTAATTACTGCATG
RaclCT009a REF TGCAGCTGGGTCTGATCCCACAAGATCCTTCATCGTCGCATG 1.00 0.38 0.00 0.00 0.00 0.62 0.91 0.06 0.04 0.13 0.04 0.81
SNP TGCAGCTGGGTCTGATTCCACAAGATCCTTCATCGTCGCATG
RaclCT010 REF TGCAGTTTTTTCTCACAATGCAGCAGCATG 0.92 0.00 0.00 0.08 0.08 0.92 0.90 0.07 0.00 0.13 0.10 0.80
SNP TGCAGTTTTTTCTCACAATACAGCAGCATG
RaclCT011*a REF TGCAGCTCACTCTGTACAGATTCCCTGCATGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGA 0.75 0.31 0.00 0.00 0.25 0.69 0.87 0.09 0.00 0.09 0.13 0.81
SNP TGCAGCTCACTCTCTACAGATTCCCTGCATGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGA
RaclCT012^ REF TGCAGCCATGTGGCTAATTAGAAGGCTGGAGGCTGCAAGTTTCTAGGCATG 0.92 0.00 0.00 0.08 0.08 0.92 0.74 0.04 0.00 0.11 0.24 0.85
SNP TGCAGCCATGTGACTAATTAGAAGGCTGGAGGCTGCAAGTTTCTAGGCATG
RaclCT013^ REF TGCAGCTGTTTTTGCCACAAAGTGCATG 0.92 0.00 0.00 0.15 0.08 0.85 0.61 0.02 0.13 0.15 0.26 0.83
SNP TGCAGCTTTTTTTGCCACAAAGTGCATG
  1. *Markers were identified originally in the adult samples, but not the tadpole samples. Consequently tadpole samples show lower levels of female homozygosity for the reference allele and males show lower levels of heterozygosity
  2. aMale tadpoles from pond Forest5 are predominantly or entirely homozygous at the reference allele, possibly indicating geographic variation in sex-linkage at this locus. Without these male tadpoles, these markers show higher sex linkage
  3. ^Markers were identified originally in the tadpoles samples, but not the adult samples. Consequently adult samples show lower levels of female homozygosity for the reference allele