Skip to main content

Table 3 Sex-linked markers and sequences for eight presence-absence (PA) loci in R. clamitans

From: Sex-linked markers in the North American green frog (Rana clamitans) developed using DArTseq provide early insight into sex chromosome evolution

  Proportion with restrction fragment sequenced
Locus Sequence Tadpoles Adults
Females Males Females Males
RaclCT014ab TGCAGTGTCTCTGAGGGTTTACTGGTGATCCAGCGCATG 0.27 0.58 0.00 0.92
RaclCT015ab TGCAGCATATGTGCGTACGGTCGGCGGGAAGGGGTTAAGCTATGTCCAGTGCCCTGCATG 0.00 0.58 0.09 0.94
RaclCT016ab TGCAGCTCAGTATCTCCGGCCTCTGTCTGTCCTGTCCTTGACAGCATG 0.00 0.62 0.04 0.92
RaclCT017ab TGCAGAAGTGCAGTGCATTGCTGTATGATTGGCCAAAGCATG 0.30 0.60 0.09 0.96
RaclCT018c TGCAGCAAGAGGTGAAAACAACCGCTGTTGGCAGCATG 0.00 1.00 0.04 0.89
RaclCT019c TGCAGTGCTTGAGATGGATCACACAGTGTGATCCATCTCAAAAACTGCGACTGTTGCATG 0.00 1.00 0.05 0.89
RaclCT020c TGCAGGCTGCAAAGAAGAAACGAGAAAGCTGCATG 0.00 1.00 0.13 0.94
RaclCT021c TGCAGCATTGCAGTGCATTGTTGTCTGATGATTGGGCAAGCATG 0.00 1.00 0.04 0.94
  1. aThese loci were originally identified as sex-linked with adult specimens but not tadpoles
  2. bThese markers are almost entirely unsequenced in male tadpoles from Forest 5. Restriction fragments for these loci were sequenced in all other male tadpoles
  3. cThese loci were originally identified as sex-linked with tadpole specimens but not adults. While perfectly sex-linked in tadpoles, they are less sex-linked in adults