Skip to main content

Advertisement

Table 2 Cold shock-induced differential expression of known miRNAs

From: MicroRNAs regulate gene plasticity during cold shock in zebrafish larvae

miRNA Mature miRNA sequence Fold change
Up-regulated miRNAs
 Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90
 Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04
 Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79
 Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75
 Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73
Down-regulated miRNAs
 Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71
 Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75
 Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79
 Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91
 Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79
  1. After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). The top 5 of 29 up- and 26 down-regulated known miRNAs (annotated in miRBase v18) are shown, along with their sequences and fold changes compared to the control groups