Skip to main content

Table 2 8plex, 5plex and 9plex primers and respective cycling conditions. The gene name, primer sequence and amplicon size are reported. Lowercase letters in the gene sequences (8plex) represent the tails added in order to obtain the same annealing temperature

From: Comparative genomics of European avian pathogenic E. Coli (APEC)

5 PLEX
Gene Name Sequence 5′–3′ Amplicon size bp
iroN F AATCCGGCAAAGAGACGAACCGCCT 553
iroN R GTTCGGGCAACCCCTGCTTTGACTTT
ompT F TCATCCCGGAAGCCTCCCTCACTACTAT 496
ompT R TAGCGTTTGCTGCACTGGCTTCTGATAC
hlyF F GGCCACAGTCGTTTAGGGTGCTTACC 450
hlyF R GGCGGTTTAGGCATTCCGATACTCAG
Iss F CAGCAACCCGAACCACTTGATG 323
Iss R AGCATTGCCAGAGCGGCAGAA
iutA F GGCTGGACATCATGGGAACTGG 302
iutA R CGTCGGGAACGGGTAGAATCG
  1. Cycling conditions: 95 °C for 5 min (Initial denaturation), followed by 35 cycles at 95 °C for 30s (denaturation), 55 °C for 30s (annealing), and 72 °C for 40s (polymerization). On completion of 35 cycles, a final polymerization was performed at 72 °C for 420 s