Skip to main content

Table 1 Genes used in “BioMolChem” chip that were analyzed in the Stratagene Mx3005P qPCR system, classified according to functions and pathways

From: High-throughput gene-expression quantification of grapevine defense responses in the field using microfluidic dynamic arrays

  Defense-related genes Names N° accession GeneBank Forward primer (5′-3′) Reverse primer (5′-3′)
Reference gene γ-chain of Elongation Factor 1 EF1γ AF176496 GAAGGTTGACCTCTCGGATG AGAGCCTCTCCCTCAAAAGG
PR proteins PR1 Unknown function PR1 AJ536326 CCCAGAACTCTCCACAGGAC GCAGCTACAGTGTCGTTCCA
Beta-1,3-glucanase (PR2) GLU AF239617 GGGGAGATGTGAGGGGTTAT TGCAGTGAACAAAGCGTAGG
Endochitinase (Chitinase IV - PR3) CHIT4a U97521.1 TATCCATGTGTCTCCGGTCA TGAATCCAATGCTGTTTCCA
proteinase inhibitor (PR6) PIN XM_002284418 ACGAAAACGGCATCGTAATC TCTTACTGGGGCACCATTTC
Chitinase III - (PR8) CHIT3 Z68123 AATGATGCCCAAAACGTAGC ATAAGGCTCGAGCAAGGTCA
PR protein - class 10 (PR10) PR10 AJ291705 GCTCAAAGTGGTGGCTTCTC CTCTACATCGCCCTTGGTGT
Polygalacturonase Inhibiting Protein PGIP XM_002263487.1 GAGCGATGCCACCCCAGTGA CCGTTGAGTCGGACGCTCGAC
Phenylpropanoid pathways Phenylalanine ammonia lyase PAL X75967 ACAACAATGGACTGCCATCA CACTTTCGACATGGTTGGTG
Stilbene synthase STS X76892.1 ATCGAAGATCACCCACCTTG CTTAGCGGTTCGAAGGACAG
Chalcone Synthase CHS X75969.1 CCAACAATGGTGTCAGTTGC CTCGGTCATGTGCTCACTGT
Chalcone Isomerase CHI X75963 AGAAGCCAAAGCCATTGAGA CCAAGGGGAGAATGAGTGAA
Anthocyanidine synthase LDOX X75966 TGGTGGGATGGAAGAGCTAC CCCACTTGCCCTCATAGAAA
Flavanone-3-hydroxylase F3H X75965.1 TGACTCGCTCTCTTCAAGCA CACCTTGGGACGTTCATCTT
Indole pathways Antranilate Synthase ANTS XM 002281597 AAAAATCCAAGAGGGGTGCT AAGCTTCTCCGATGCACTGT
Chorismate mutase CHORM FJ604854 TCATTGAGAGGGCCAAATTC AGGAGGCAGAAAAAGCATCA
Chorismate Synthase CHORS FJ604855 GCCTTCACATGCAGATGCTA CTGCAACTCTCCCAATGGTT
Redox status Glutathione S-transferase GST1 AY156048.1 GGGATCTCAAAGGCAAAACA AAAAGGGCTTGCGGAGTAAT
Lipoxygenases Lipoxygenase-9 LOX9 AY159556 GACAAGAAGGACGAGCCTTG CATAAGGGTACTGCCCGAAA
Signaling 1-aminocyclopropane, 1-carboxylic oxidase ACC AF424611 GAAGGCCTTTTACGGGTCTC CCAGCATCAGTGTGTGCTCT
Cell Wall Reinforcement Glycosyl transferase CAGT XM02273320.1 TCGGAAGGGAATGCAATAAG TGTAGGAGGAACCACCCTTG
Callose Synthase CALS AJ430780.1 TGGAAATGCAATTCAAACGA CGAATGCCATGTCTGTATGG
Lignin-forming peroxidase PER XM_002274762.1 TAAGCGCCACAAGAACACTG GGACCTCCTTGTTGAGTCCA