Skip to main content

Table 2 Primer and probe sets for qPCR analysis

From: Differential expression of alternatively spliced transcripts related to energy metabolism in colorectal cancer

Gene Transcripts (UCSC database) Direction Primer sequence, 5’ → 3’ Amplicon size, bp
COL6A3 universal Forward
Reverse
Probe
TCCAAGCCAAGAACGCAGA
TGACGCCCTCAGAGCCAT
ACGGAGCACCAGCACCAGTTTCAGG
204
uc002vwo / NM_057167
uc002vwq / NM_057165 (not expressed according to RNA-Seq data)
Forward
Reverse
Probe
ACACACGCCTTCAGGTTTGC
GACTGCGAAATTGACACTTCCG
CAGCAGCAGCAAGCAGCACAAGACTC
218
ICAM1 universal Forward
Reverse
Probe
CACCCCAGAGGACAACGG
TGGCACATTGGAGTCTGCTG
CCGGCCAGCTTATACACAAGAACCAGA
180
uc010xle / AK301412 Forward
Reverse
Probe
CGCTATGGCTCCCAGCAG
TGGCAGCGTAGGGTAAGGTTC
TCTGTTCCCAGGGACTCCAGAACGG
147
OGDH universal Forward
Reverse
Probe
AAGTCTAGTGAGAATGGCGTGGACT
CAAGGTAATGTTCCTGTCGGTGAC
TTCAGCCGCCCTCTGTGTGGCAT
219
uc011kby / AK296400 Forward
Reverse
Probe
GATGTACTGTGCTTGGCTGGAAA
GATGATCTCCCGCAGAGGAAGT
CAGGCCATAGAACCCTTATGTACACTTTTGGG
147
PHPT1 universal Forward
Reverse
Probe
AAGTACCCCGACTACGAGGTCA
GGCTCTGAAGTGGCTGCTG
CTAACGACGGCTACTGAGCACTCCCA
92
uc004cjq / NM_014172 Forward
Reverse
Probe
AAGGCTGCGACTGTGAGTGTCT
CTCAGTTGAAATGGCGTGCTG
CGGCTATTCCATGGCCTATGGTCCTG
122
PPP2R5D universal Forward
Reverse
Probe
CGGGACTTCCTCAAGACCATT
ATGATGCTGCCCAGGATCTC
CACATCTTCTACAGGTTCATCTACGAGACGGA
161
uc010jyd / NM_180977 Forward
Reverse
Probe
GGCCGAGATGCCCTATAAACT
TTGAGTCCTGCCCGCTTC
CTTCTGGATAAACAGCTCCTTCTCCTTTTTCAG
138
SLC29A1 universal Forward
Reverse
Probe
CATTTTGACCATCATCTGTTACCTG
GGTCCAACTTGGTCTCCTGCT
CCCCGCCTGGAATTCTACCGCTACTA
107
uc003owz / NM_001078177 Forward
Reverse
Probe
GAGCCTGAGGACCCTGCG
CGATGGGGATCACCCGTC
CAACGTGACCGCAGCCTGTTTTAGGC
127
TRIB3 universal Forward
Reverse
Probe
GCGTGATCTCAAGCTGTGTCG
GCCTTGCCCGAGTATGAGG
CAGCTTCTTCCTCTCACGGTCAGCGAAG
183
uc002wdm / NM_021158 Forward
Reverse
Probe
ACCTGCTGGTGCCCTGGAG
CGTTTCTGGACGGGACGCT
ACGGGGCGAGATGCGAGCCACC
168
uc002wdn / AK297546 Forward
Reverse
Probe
GTCATCCCAGCCTCGAACCT
TCCAACTCCAACCGCTTCTTC
TACCTGGCAACAGATGCGAGCCACC
191
  1. Only UCSC hg19 target transcripts are listed