Skip to main content

Table 1 Details of primers used for RT-qPCR

From: Functional changes in mRNA expression and alternative pre-mRNA splicing associated with the effects of nutrition on apoptosis and spermatogenesis in the adult testis

Gene Abbrev. Sequence Product length (bp)
Piwi-Like RNA-Mediated Gene Silencing 1 PIWIL1 F:CTGGTTCTCTCGCTGTGTGT 90
  R:TTCCAAGCCCTTAGAGCAGC
Spermatogenesis Associated 4 SPATA4 F:CTCTCGATCACCATCCTGCC 106
  R:CTCAATGCACTCATGCTCGC
Inhibin beta A INHBA F:AGGTGGTGGATGCTCGAAAG 125
  R:GGTCTCCTGACACTGCTCAC
Forkhead box O3 FOXO3 F:ATGGCAACCAGACACTCCAG 97
  R:CTGGCCTGAGACATCAAGGG
Phosphatase and tensin homolog PTEN F:CGGCCGTTCCGAGGATT 99
  R:CTGGATGGTTGCAGCGACT
Cytochrome P450, Family 51, Subfamily A, Polypeptide 1 CYP51A1 F:TACCTACCTGCTGGGGAGTG 107
  R:TCCCAAACACAGGTGTCGTC
Glyceraldehyde-3-phosphate dehydrogenase GAPDH F:CTGCTGACGCTCCCATGTTTGT 150
  R:TAAGTCCCTCCACGATGCCAAA