Genome-wide expression profiling in muscle and subcutaneous fat of lambs in response to the intake of concentrate supplemented with vitamin E

González-Calvo, Laura; Dervishi, Elda; Joy, Margalida; Sarto, Pilar; Martin-Hernandez, Roberto; Serrano, Magdalena; Ordovás, Jose M.; Calvo, Jorge H.

doi:10.1186/s12864-016-3405-8

Table 7 Primers forward and reverse used in RT-PCR

From: Genome-wide expression profiling in muscle and subcutaneous fat of lambs in response to the intake of concentrate supplemented with vitamin E

PCR conditions^a
Symbol	Gene	Primers forward and reverse	Amplicon bp	AT	nM	E	R ²
CISH	Cytokine inducible SH2-containing protein	F:5′-agccaagaccttctcctacct-3′	96	60	600/600	1.98	0.99
CISH	Cytokine inducible SH2-containing protein	R:5′-acgaggaagacagtgaagacg-3′	96	60	600/600	1.98	0.99
ABCC4	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	F: 5′-ccgtgagaaatttgcccactg-3′	128	60	900/900	2.00	0.99
ABCC4	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	R: 5′- gcaaaacatacggctcatcat-3′	128	60	900/900	2.00	0.99
ACAT1	A cetyl-Coenzyme A acetyltransferase 1	F: 5′-gagctgtttctcttggacatcc-3′	118	60	900/900	1.98	0.99
ACAT1	A cetyl-Coenzyme A acetyltransferase 1	R: 5′- cctcctcctccgttgcaaat-3′	118	60	900/900	1.98	0.99
IGF1R	Insulin-like growth factor 1 receptor	F: 5′-ccaaggcctgagaactccat-3′	122	60	900/900	2.00	0.98
IGF1R	Insulin-like growth factor 1 receptor	R: 5′- ctggacacacattcccgct-3′	122	60	900/900	2.00	0.98
LDLR	Low density lipoprotein receptor	F:5′- gcatcaacttcgacaaccct -3′	112	60	600/600	2.00	0.98
LDLR	Low density lipoprotein receptor	R:5′- tcctccaagctgaccatctg -3′	112	60	600/600	2.00	0.98
SQLE	Squalene epoxidase	F:5′-aatgtgttgcaggtccggtt-3′	88	60	600/600	1.98	0.98
SQLE	Squalene epoxidase	R:5′- tagactgcgacgccaaagaa -3′	88	60	600/600	1.98	0.98
SREBF1	Sterol regulatory element binding transcription factor 1	F:5′- ctgctatgcaggcagcac -3′	99	60	200/200	2.00	0.98
SREBF1	Sterol regulatory element binding transcription factor 1	R:5′- ggttgatgggcagcttgt -3′	99	60	200/200	2.00	0.98
SOD3	Superoxide dismutase 3, extracellular	F:5′-atccacgtgcaccagtttg-3′	110	60	300/300	2.00	0.98
SOD3	Superoxide dismutase 3, extracellular	R:5′-aagttgccaaagtcgccc-3′	110	60	300/300	2.00	0.98
HAX1	HCLS1 associated protein X-1	F:5′-taacccatcaagaggcaggc-3′	115	60	600/600	1.99	0.99
HAX1	HCLS1 associated protein X-1	R:5′-gaccggaaccaacgtcctag-3′	115	60	600/600	1.99	0.99
HMGB2	High-mobility group box 2	F:5′-gccgtatgaacagaaagcagc-3′	126	60	600/600	1.94	0.99
HMGB2	High-mobility group box 2	R:5′-ttcttcttggagcctgtcgg-3′	126	60	600/600	1.94	0.99
HSPB8	Heat shock 22 kDa protein 8	F:5′-agcaagaaggtggcatcgtt-3′	126	60	400/400	2.00	0.99
HSPB8	Heat shock 22 kDa protein 8	R:5′- cctggggagcttcgatgatc-3′	126	60	400/400	2.00	0.99
IER3	Immediate early response 3	F:5′-ttcaccttcgaccctctccc-3′	130	60	400/400	1.90	0.97
IER3	Immediate early response 3	R:5′- cctcgactggcagctgac-3′	130	60	400/400	1.90	0.97
METTL1	Methyltransferase like 1	F:5′-ggagctgcatgagtggatgt-3′	104	60	600/600	1.97	0.99
METTL1	Methyltransferase like 1	R:5′- tgcccagatgtcccacaatg-3′	104	60	600/600	1.97	0.99
GUSB	β-glucuronidase	F:5′-gcttcgagcagcagtggta-3′	86	60	600/600	1.99	0.99
GUSB	β-glucuronidase	R:5′-cacgtcgttgaagctggac-3′	86	60	600/600	1.99	0.99
YWHAZ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein	F:5′- tgtaggagcccgtaggtcatct-3′	102	60	400/400	1.99	0.98
YWHAZ		R:5′ - ttctctctgtattctcgagccatct-3	102	60	400/400	1.99	0.98

^aReal-time PCR conditions: annealing temperature (AT), primer concentrations (nM), E: primer efficiency and R ²: correlation coefficient

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com

BMC Genomics

Contact us