Skip to main content

Table 2 Primer design of miRNA

From: Effects of exposure to Streptococcus iniae on microRNA expression in the head kidney of genetically improved farmed tilapia (Oreochromis niloticus)

Name Primer sequence (5’-3’)
miR-92 AATTGCACTCGTCCCGGC
miR-310-3p TATGGCACTTCTCCCGGCCTG
miR-127 ATCGGATCCGTACTAGTGGTG
miR-599 GAAGTGTTACTGTGGAGGTCT
miR-92d-3p TATGGCACTTATCCCGGCC
miR-146-3p AGCGCTGTGGATCTTCGGTTTTC
miR-694 CTGAAAATGTATGGCGCTGGAG
miR-375-5p ACTTGAGCGCGTGCGATAG