Skip to main content

Table 3 Ten abundant existing carp miRNAs identified in Yellow River carp

From: Identification and profiling of Cyprinus carpio microRNAs during ovary differentiation by deep sequencing

miRNA Sequence neurula stage yolk sac complete absorption stage primordial germ cells stage juvenile ovary adult ovary
Frequency
ccr-miR-430 TAAGTGCTATTTGTTGGGGTAG 1846122 10701 11 15 4
ccr-miR-21 TAGCTTATCAGACTGGTGTTGGC 128047 191505 772028 42406 158595
ccr-let-7a TGAGGTAGTAGGTTGTATAGTT 1455 50461 407120 94104 328220
ccr-miR-199-5p CCCAGTGTTCAGACTACCTGTTC 1656 511142 366414 13362 15179
ccr-miR-9-3p TCTTTGGTTATCTAGCTGTATG 5022 852887 1529 1272 405
ccr-miR-22a AAGCTGCCAGCTGAAGAACTGT 28851 202470 400577 39619 136304
ccr-miR-125b TCCCTGAGACCCTAACTTGTGA 839 255585 270975 37470 47113
ccr-miR-26a TTCAAGTAATCCAGGATAGGCT 18731 144765 360828 25777 50053
ccr-miR-181a AACATTCAACGCTGTCGGTGA 2652 413308 144273 7212 14370
ccr-miR-101a TACAGTACTGTGATAACTGAAG 6654 58068 389930 14286 40151