Skip to main content

Table 4 Primers used for rotavirus genome enrichment amplification

From: A universal genome sequencing method for rotavirus A from human fecal samples which identifies segment reassortment and multi-genotype mixed infection

Primer name Primer sequences (5'-3')
FR20RV
Modified FR26RVN
FR26RV-VP7-F
FR26RV-VP7-R
GCCGGAGCTCTGCAGATATC
GCCGGAGCTCTGCAGATAT-non ribosomal hexanucleotides [2]
GCCGGAGCTCTGCAGATATCGGCTTTAAAAG
GCCGGAGCTCTGCAGATATCGGTCACATCATA
FR26RV-VP4-F
FR26RV-VP4-R
FR26RV-VP4-F2
FR26RV-VP4-R2
GCCGGAGCTCTGCAGATATCGGCTATAAAATG
GCCGGAGCTCTGCAGATATCGGTCACATCCTC
GCCGGAGCTCTGCAGATATCTGGCTTCGCCAT
GCCGGAGCTCTGCAGATATCATTTCGGACCAT
FR26RV-VP6-F
FR26RV-VP6-R
GCCGGAGCTCTGCAGATATCGGCTTTWAA ACG
GCCGGAGCTCTGCAGATATCGGTCAC ATCCTC
FR26RV-VP1-Fb
FR26RV-VP1-Rb
GCCGGAGCTCTGCAGATATCGGCTATTAAAGC
GCCGGAGCTCTGCAGATATCGGTCACATCT
FR26RV-VP2-Fc
FR26RV-VP2-Rc
GCCGGAGCTCTGCAGATATCGGCTATTAAAGG
GCCGGAGCTCTGCAGATATCGTCATATCTCCA
FR26RV-VP3-Fe
FR26RV-VP3-Re
GCCGGAGCTCTGCAGATATCGGCTWTTAAAGC
GCCGGAGCTCTGCAGATATCGGTCACATCATG
FR26RV-NSP1-F
FR26RV-NSP1-R
GCCGGAGCTCTGCAGATATCGGCTTTTTTTTATG
GCCGGAGCTCTGCAGATATCGGTCACATTTTATGC
FR26RV-NSP2-F
FR26RV-NSP2-R
GCCGGAGCTCTGCAGATATCGGCTTTTAAAGC
GCCGGAGCTCTGCAGATATCGGTCACATAAGC
FR26RV-NSP3-F
FR26RV-NSP3-R
FR26RV-NSP3-R2
GCCGGAGCTCTGCAGATATCGGCTTTTAATGC
GCCGGAGCTCTGCAGATATCACATAACGCCCCTAT
GCCGGAGCTCTGCAGATATCGGTCACATAACG
FR26RV-NSP4-F1
FR26RV-NSP4-F2
FR26RV-NSP4-R1
FR26RV-NSP4-R2
GCCGGAGCTCTGCAGATATCGGCTTTTAAAAGTTC
GCCGGAGCTCTGCAGATATCGCDTCAATTCCAAC
GCCGGAGCTCTGCAGATATCTAAGACCRTTCC
GCCGGAGCTCTGCAGATATCCTCCGCCGCTTCCGA
FR26RV-NSP5-F1
FR26RV-NSP5-F2
FR26RV-NSP5-R1
FR26RV-NSP5-R2
GCCGGAGCTCTGCAGATATCGGCTTTTAAAGCGCT
GCCGGAGCTCTGCAGATATCGGCTTTTAAAGCGCT
GCCGGAGCTCTGCAGATATCCTATCTGAATCATC
GCCGGAGCTCTGCAGATATCGGTCACAAAACGGGA