Skip to main content

Advertisement

Table 4 Primers used for rotavirus genome enrichment amplification

From: A universal genome sequencing method for rotavirus A from human fecal samples which identifies segment reassortment and multi-genotype mixed infection

Primer name Primer sequences (5'-3')
FR20RV Modified FR26RVN FR26RV-VP7-F FR26RV-VP7-R GCCGGAGCTCTGCAGATATC GCCGGAGCTCTGCAGATAT-non ribosomal hexanucleotides [2] GCCGGAGCTCTGCAGATATCGGCTTTAAAAG GCCGGAGCTCTGCAGATATCGGTCACATCATA
FR26RV-VP4-F FR26RV-VP4-R FR26RV-VP4-F2 FR26RV-VP4-R2 GCCGGAGCTCTGCAGATATCGGCTATAAAATG GCCGGAGCTCTGCAGATATCGGTCACATCCTC GCCGGAGCTCTGCAGATATCTGGCTTCGCCAT GCCGGAGCTCTGCAGATATCATTTCGGACCAT
FR26RV-VP6-F FR26RV-VP6-R GCCGGAGCTCTGCAGATATCGGCTTTWAA ACG GCCGGAGCTCTGCAGATATCGGTCAC ATCCTC
FR26RV-VP1-Fb FR26RV-VP1-Rb GCCGGAGCTCTGCAGATATCGGCTATTAAAGC GCCGGAGCTCTGCAGATATCGGTCACATCT
FR26RV-VP2-Fc FR26RV-VP2-Rc GCCGGAGCTCTGCAGATATCGGCTATTAAAGG GCCGGAGCTCTGCAGATATCGTCATATCTCCA
FR26RV-VP3-Fe FR26RV-VP3-Re GCCGGAGCTCTGCAGATATCGGCTWTTAAAGC GCCGGAGCTCTGCAGATATCGGTCACATCATG
FR26RV-NSP1-F FR26RV-NSP1-R GCCGGAGCTCTGCAGATATCGGCTTTTTTTTATG GCCGGAGCTCTGCAGATATCGGTCACATTTTATGC
FR26RV-NSP2-F FR26RV-NSP2-R GCCGGAGCTCTGCAGATATCGGCTTTTAAAGC GCCGGAGCTCTGCAGATATCGGTCACATAAGC
FR26RV-NSP3-F FR26RV-NSP3-R FR26RV-NSP3-R2 GCCGGAGCTCTGCAGATATCGGCTTTTAATGC GCCGGAGCTCTGCAGATATCACATAACGCCCCTAT GCCGGAGCTCTGCAGATATCGGTCACATAACG
FR26RV-NSP4-F1 FR26RV-NSP4-F2 FR26RV-NSP4-R1 FR26RV-NSP4-R2 GCCGGAGCTCTGCAGATATCGGCTTTTAAAAGTTC GCCGGAGCTCTGCAGATATCGCDTCAATTCCAAC GCCGGAGCTCTGCAGATATCTAAGACCRTTCC GCCGGAGCTCTGCAGATATCCTCCGCCGCTTCCGA
FR26RV-NSP5-F1 FR26RV-NSP5-F2 FR26RV-NSP5-R1 FR26RV-NSP5-R2 GCCGGAGCTCTGCAGATATCGGCTTTTAAAGCGCT GCCGGAGCTCTGCAGATATCGGCTTTTAAAGCGCT GCCGGAGCTCTGCAGATATCCTATCTGAATCATC GCCGGAGCTCTGCAGATATCGGTCACAAAACGGGA