Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: Effects of dietary physical or nutritional factors on morphology of rumen papillae and transcriptome changes in lactating dairy cows based on three different forage-based diets

Gene Gene Bank ID Primers Primer sequence (5’-3’) Amplicon Size References
HLA-DQA1 BT020994.1 Forward CCTTGTGGGTATCGTGGTGG 150 bp This study
Reverse CGTCTAGCACGTCCACTCTT
PI3 XM_005214890.3 Forward TGACTGGGCAAGGGGAGCCG 112bp This study
Reverse GGGGCCACCCCAAAGAAGCC
HSPB8 BT020640.1 Forward CAGTCTTGGCCCTTCCTTGT 176bp This study
Reverse TCAATTGCGCCATCTTGCAG
PRSS53 XM_015469379.1 Forward TGCACAGCTAACATGAGCCA 148 bp This study
Reverse CCAGAGCCCTTTGCACTGTA
DSG1 NM_174045.1 Forward ATCCAACTGACTTGCTCGCT 278 bp This study
Reverse ACCACCACCAGTTGTGTAGC
BAG3 BC133574.1 Forward ACGCAGTAACTTGGGTGGAG 148 bp This study
Reverse ACAGAGACGGCTCCAAAACA
CYR61 NM_001034340.2 Forward GATGCAACTACAACTGCCCG 116 bp This study
Reverse CCACCCTTATGCTGGAAGCC
IGFBP3 NM_174556.1 Forward TTAATGCCTGCACATCCCGA 259 bp This study
Reverse CCCTATGGGGCTTCAGCAAA
GAPDH BC102589 Forward TGGAAAGGCCATCACCATCT 60 bp [31]
Reverse CCCACTTGA TGTTGGCAG
β-actin NM-173979 Forward GCCATGAAGCTGAAGATGAC 229 bp [29]
Reverse CCTTCTGCAGCTCAGATATG