Skip to main content

Table 1 Rainbow trout primer sequences used for qPCR

From: Gene expression profile during proliferation and differentiation of rainbow trout adipocyte precursor cells

Gene Accession number Primer sequence (5'-3') Annealing T (°C)
ACSL1 CR363150.p.om.8 F: TGCAATCTAGCAAGGTTCCTTTTG 60
R: TCCAAGCAGAAACCCAGTACAGAA
GPDH AF027130.p.om.8 F: ATGACCACAGTCCACGCCTACAC 60
R: GGCAGGTTAGGTCCACCACTGA
IGFBP5 DQ206713 F: ACTTCACGCGCTTCTCCATGGCA 60
R: CGAGACTCATGATCTATGGGTGGA
IGFBP7 DQ146965 F: GCTCCGATGGAGTGACCTATA 60
R: ACAATGACAGGTGCTGTTGCG
PCNA CA358086.s.om.10 F: ATACGGGCAAACTCTCCTGATGGC 60
R: CAACGCAGACACACTCGCCCTT
cPEPCK [26] F: CCCAGTGCCTGTGGGAAAAC 60
R: CCACACCGAAAAAGCCGTTC
PLIN2 CB494091.p.om.8 F: GATGGCAATGAGGCAGAGAACA 60
R: AGGCAGAGTGGCTAAGGGACAG
18S AF308535 F: CGGAGGTTCGAAGACGATCA 60
R: TCGCTAGTTGGCATCGTTTAT
  1. F, forward; R, rever se; T, temperature