Complete sequence and comparative genomic analysis of eight native Pseudomonas syringae plasmids belonging to the pPT23A family

Table 3 Bioinformatic predictions of main characteristics of putative type III effector proteins found in pPg2708 plasmid

Putative type III effectors	Size (aa)	Signal peptide	T. domains^a	Hrp-box^b
AvrD1	311	32–44	ND	ggaaccaaatccgtcccaaaggccacaca
AvrRps4	228	ND^c	ND	ND
HopAU1	731	30–42	ND	ggaaccctcctgtgattttcgaacactca
HopBD1	300	110–122	ND	ggaaccgatcgaggggttctgaccacata
HopD1	713	45–57	ND	ggaacccaagagcccttgcgaccacaca
HopH1	218	12–24	ND	ggaactatcctcccacacgaagccactta

^a Transmembrane domains
^b Hrp-box is a cis promoter element recognized by the alternate sigma factor HrpL and is associated mainly with genes encoded in the type III secretion system of plant pathogenic bacteria
^c Non-detected

ISSN: 1471-2164