Skip to main content

Advertisement

Table 1 Oligonucleotides

From: Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries

Primer Application Sequence
Primers for linear PCR
EGFR-ex20_NNN PCR-based introduction of UMI (UMI-containing primer), contains partial sequence of TruSeq Illumina adapter ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNCATCTGCCTCACCTCCACCGT
EGFR- ex18-1reg_NNN ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNGAAGCTCCCAACCAAGCTC
EGFR- ex19-1reg_NNN ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNCTGTCATAGGGACTCTGGAT
EGFR -ex21_R_NNN ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNTCTTTCTCTTCCGCACCCAG
EGFR -ex22_NNN ACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNCATCCCAAGGTGCCTATCAA
NOPE oligos
NOPE-R1 Neutralization of EGFR-ex20_NNN GCACGCGTCGACGGTGGAGGTG-BHQ1
NOPE-R2 ACACGACGCTCTTCCGATCTACGGTGGAGGTGAGGCAG-BHQ1
NOPE-R3 GCACGCGTCGACGGTGGAGGTGAGGCAG-BHQ1
NOPE-R0 ACGGTGGAGGTGAGGCAG-BHQ1
NOPE-EGFR- ex18 Neutralization of EGFR-ex18-1reg_NNN TCACACGTCTGAGCTTGGTTGGGAGCTTC-BHQ1
NOPE-EGFR-ex19 Neutralization of EGFR- ex19-1reg_NNN ATACTCTTCGATCCAGAGTCCCTATGACAG-BHQ1
NOPE- EGFR-ex21 Neutralization of EGFR-ex21_R_NNN CTTGACGTCACTGGGTGCGGAAGAGAAAGA-BHQ1
NOPE- EGFR-ex22 Neutralization of EGFR-ex22_NNN ACTCTCATCCTTGATAGGCACCTTGGGATG-BHQ1
Primers for the 1st PCR
EGFR-ex20_R1 Reverse nested EGFR-ex20-specific primer 1 TGTTCCCGGACATAGTCCAG
EGFR-ex18-1reg_ R1 Reverse nested EGFR-ex18-specific primer 1 AACGCACCGGAGCCCAGCACT
EGFR-ex19-1reg_R1 Reverse nested EGFR-ex19-specific primer 1 GATTTCCTTGTTGGCTTTCGGA
EGFR-ex21_F1 Forward nested EGFR-ex21-specific primer 1 CTGGTGAAAACACCGCAGCA
EGFR-ex22_R1 Reverse nested EGFR-ex22-specific primer 1 GCTCCAGACATCACTCTGGT
TruSeq-short Step-out primer 1 TACACGACGCTCTTCCGATCT
Primers for 2nd PCR
EGFR-ex20_R2 Reverse nested EGFR-ex20-specific primer 2, contains partial sequence of TruSeq Illumina adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACATAGTCCAGGAGGCAGC
EGFR-ex18-1reg_R2 Br Reverse nested EGFR-ex18-specific primer 2, contains partial sequence of TruSeq Illumina adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGGAGCCCAGCACTTTGATC
EGFR-ex19-1reg_R2 Br Reverse nested EGFR-ex19-specific primer 2, contains partial sequence of TruSeq Illumina adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGTTGGCTTTCGGAGATGTT
EGFR-ex21_F2 Br Forward nested EGFR-ex21-specific primer 2, contains partial sequence of TruSeq Illumina adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAACACCGCAGCATGTCAAG
EGFR-ex22_R2 Br Reverse nested EGFR-ex22-specific primer 2, contains partial sequence of TruSeq Illumina adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACATCACTCTGGTGGGTATAG
TruSeq-long Step-out primer 2, contains sequence of TruSeq Illumina adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Primers for 3rd PCR (introducing Illumina indexes)
TruSeq-Index1 Reverse step-out primer, anneals on the EGFR-ex20_R2, contains complete sequence of TruSeq Illumina adapter with sample index CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGT
Illumina-Dir Forward step-out primer 3 AATGATACGGCGACCACCGAGATC
Real time PCR probes
Z-IGFR ex20 Real time PCR probe for exon 20. Fam-AGCTCATCACGCAGCTCATGCCCTT-BHQ1
Z-TruUni Universal real time PCR probe for TuSeq adapter Fam-ACACTCTTTCCCTACACGACGCTCTT-BHQ1