Skip to main content

Table 4 Genetic diversity analysis with InDel markers developed in radish

From: Comparative transcriptomics uncovers alternative splicing and molecular marker development in radish (Raphanus sativus L.)

InDel Primer name Scaffold Position Expected Na HO HE PIC Forward primer Reverse primer
size (bp)
NAU-RsInDel1 Rsa1.0_02158.1 133,381 124 2 0.27 0.36 0.38 TCCAGCACCAAGAACTAT TAAAACACCACCAAAAGG
NAU-RsInDel2 Rsa1.0_04545.1 9016 154 2 0.27 0.51 0.46 GTCGGATTTGGTAAAGAGG CGTCCCTGAACTGGTCATA
NAU-RsInDel3 Rsa1.0_00949.1 39,724 141 2 0.53 0.47 0.44 CATCTTCGGGATCAACGG ATCGGACAACTCAAAACCAACT
NAU-RsInDel4 Rsa1.0_00251.1 287,457 180 2 0 0.5 0.49 AGACTGCCGAGTATCAAT AATCGCTGGAGAAGAAAT
NAU-RsInDel5 Rsa1.0_03247.1 13,547 96 2 0.16 0.25 0.26 AGTGTCTTTGCGGCATCT TAGGGTTTGCGATTTGGA
NAU-RsInDel6 Rsa1.0_00071.1 141,781 111 2 0.25 0.5 0.51 TGAGGAAACAGAACAAGA GCTTAGGCTTAGCATTAT
NAU-RsInDel7 Rsa1.0_00660.1 52,677 175 2 0.16 0.43 0.38 TGCTATCAAAACGCAAAT CAAGGAAAATAAAACTATGGAG
NAU-RsInDel8 Rsa1.0_01209.1 39,624 112 2 0.07 0.43 0.41 ATCATCAATCTCGCTCTTT AGACTATCACCTCCTCTGC
NAU-RsInDel9 Rsa1.0_01100.1 52,433 153 2 0.31 0.35 0.28 AGCAGCCAGTGAGATTAG ACACGGTATTTTCCAACC
NAU-RsInDel10 Rsa1.0_00232.1 38,667 162 2 0.52 0.51 0.42 TAGTGAGTGAAGACACCAAC TTAAAGCTGCAGAAGAAG
NAU-RsInDel11 Rsa1.0_01156.1 25,754 165 2 0.1 0.34 0.32 CCCTCTGCTTTCATCCTT TCTCCGCTGACCACAATT
NAU-RsInDel12 Rsa1.0_15591.1 936 140 2 0.39 0.39 0.35 TACTCCAAATTCGCATCA TCATCGGAAGGTAAGACG
NAU-RsInDel13 Rsa1.0_01184.1 26,764 177 2 0.07 0.29 0.37 ATGATTCTCCATCCAAGC GTCGCATTTTCATTTCCT
NAU-RsInDel14 Rsa1.0_03334.1 18,880 127 4 0.41 0.75 0.69 CTACTTGTCCGAGCTTCA TAACTCCCGTTGTTGATA
NAU-RsInDel15 Rsa1.0_27069.1 235 109 2 0.25 0.31 0.26 TTATGAGAAACGTCAAGG AGTGGAGAAAGGAACAAG
NAU-RsInDel16 Rsa1.0_20672.1 478 172 3 0.19 0.51 0.45 TAGAGGGTGAAACGCAGGAA TTGGGAAGTGGAACAAAGCA
NAU-RsInDel17 Rsa1.0_00250.1 39,440 164 2 0.19 0.36 0.33 ATTTCAACAGATAAACCGACAC GCCTGAGCCCATCAACTA
NAU-RsInDel18 Rsa1.0_02411.1 6272 178 2 0.06 0.48 0.41 GGGAACCCAACAACCTAT TTATTCGACGGCACAAAC
NAU-RsInDel19 Rsa1.0_00016.1 354,003 162 2 0.46 0.46 0.53 TCCAAGGCTAGTAGAAAC TGACATCCAACAAAGACA
NAU-RsInDel20 Rsa1.0_01401.1 93 134 2 0.34 0.47 0.35 AAATAAGACACGAAACCCTG ATCGAAACTCCTCCCTCC
NAU-RsInDel21 Rsa1.0_01219.1 21,510 148 2 0.13 0.5 0.45 ACAACAACGGAGACTTGG GTGAACCTGTCGGCTATG
NAU-RsInDel22 Rsa1.0_00816.1 110,085 145 2 0.17 0.48 0.44 GTCCGAACAAAAGGTGAGATT ACTATTGATTTGATTTGGGTTGTG
NAU-RsInDel23 Rsa1.0_00744.1 53,460 145 2 0.37 0.44 0.42 TCTCAAGGACCCAACACTACA TTGCAAAACTGGAAAAGGAA
NAU-RsInDel24 Rsa1.0_02097.1 17,223 124 2 0.19 0.42 0.37 TAAAATTGATAAACCTGCTC CTGTGATTCTGAACCTCC
NAU-RsInDel25 Rsa1.0_01975.1 14,276 163 2 0.03 0.03 0.09 CCAGAAAACGAATGAAAAACTACT AGAAACACATGGCTGAGAGGA
NAU-RsInDel26 Rsa1.0_00101.1 211,799 180 2 0.34 0.5 0.37 CAGCGAAACCACAAACACAA GCTAAGTCTCCCTCCTCCATT
NAU-RsInDel27 Rsa1.0_04806.1 7466 184 2 0.31 0.41 0.32 TGTATTAACCACCACCAT CACGAAAGATAACAACTCAA
NAU-RsInDel28 Rsa1.0_04167.1 18,003 200 2 0.19 0.35 0.28 TCTCACCCCAGCCACTTT TATCCCACCTGTCTCGTT
NAU-RsInDel29 Rsa1.0_02690.1 16,462 165 2 0.25 0.51 0.38 AATCTTCCTGCGCCACAT TCGTTTGCCTTCTCCTCA
NAU-RsInDel30 Rsa1.0_08988.1 3062 105 2 0.23 0.49 0.41 AGAGGGAAGCCACTATCA TTCCGAAGATTAGATGAGAT
NAU-RsInDel31 Rsa1.0_14009.1 2697 189 3 0.26 0.46 0.42 TCTTGTTCTTTGGGTAAT AAGGACTCAATCTATGGC
NAU-RsInDel32 Rsa1.0_02642.1 14,660 104 3 0.03 0.48 0.5 TACAATAAAACCCTCAAG AAGTGGTGATAAGGAAAC
NAU-RsInDel33 Rsa1.0_02467.1 15,972 131 2 0.03 0.5 0.45 CAGATAAAGCCAAAAGTC ATCTGTTTTACTTGGAGC
NAU-RsInDel34 Rsa1.0_02467.1 15,842 130 3 0.28 0.57 0.49 TCTCAAACCAAGGAAACC ACGAAGAACTACGAGGCT
NAU-RsInDel35 Rsa1.0_00012.1 70,110 193 2 0.41 0.5 0.37 TTTTCGAGAAGAAGAAAGTC GGACAAATACTGCCACAT
NAU-RsInDel36 Rsa1.0_00042.1 55,669 124 2 0.28 0.48 0.36 TAAAAGCCAATACAGAAG CACAGACGAAAGACCATA
NAU-RsInDel37 Rsa1.0_00105.1 127,102 105 2 0.29 0.5 0.41 GGAGGAAGACGAGTTGAT TGAGACGTTTTGGAAGTG
NAU-RsInDel38 Rsa1.0_01482.1 15,564 102 2 0.26 0.41 0.49 TAAAATAACAAATCACTCCCTC CTAACCCTAATCGCACCC
NAU-RsInDel39 Rsa1.0_00816.1 109,998 140 2 0.25 0.51 0.38 CTCACAACCCAAATCAAA TACCTGGAGGAAGGAAAG
NAU-RsInDel40 Rsa1.0_04618.1 3100 117 2 0.47 0.49 0.45 GAAGAGCTGGAGAAGGAA AGGCCAACTGCTAGTAGATT