Skip to main content

Table 1 Features of the 25 most abundant representative RNA fragments

From: Small RNA fragments derived from multiple RNA classes – the missing element of multi-omics characteristics of the hepatitis C virus cell culture model

Sequence Length Parental RNA RNA class Fragment type Relative abundance
72C 72I 96C 96I
CACCACGUUCCCGUGG 16 Putative conserved non-coding region (RNAz) other n/ab 164.31% 137.42% 97.74% 81.31%
GUUUGUGAUGACUUACA 17 C/D box snoRNA, SNORD30/U30 snoRNA box C 147.21% 109.31% 73.54% 139.20%
UCGUACGACUCUUAGCGG 18 Homo sapiens tRNaseZL-interacting RNA B2 other n/a 106.20% 77.68% 59.03% 112.86%
GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCU 33 tRNA, AAC (Val) tRNA tRF-5A 94.61% 85.11% 226.16% 296.63%
CUGGAUGAUGAUAAGCAAAUGCUGACUGAAC 31 C/D box snoRNA, SNORD44/U44 snoRNA box C 49.19% 35.07% 36.15% 41.96%
ACCACGUUCCCGUGG 15 Putative conserved non-coding region (RNAz) other n/a 39.10% 39.74% 47.31% 33.02%
GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUC 34 tRNA, CAC (Val) tRNA tRF-5A 30.75% 15.72% 51.93% 31.72%
UUGCUGUGAUGACUAUCUUAGGACACCUU 29 C/D box snoRNA, SNORD58/U58 snoRNA box C, guide sequence 1 28.55% 20.87% 13.10% 22.32%
CCUGUGAACUCAAAAGGCUCUUUUCAGAGCCACU 34 mRNA, HIST2H2AA3 mRNA n/a 26.32% 17.69% 13.46% 12.49%
GGUCCAGGAUGAAACCUAAUUUGAGUGGACAUCCAUGGAUGAGAAAUGCGGAUAUGGGACUGAGA 65 C/D box snoRNA, HBII-420/SNORD99 snoRNA box C, D, guide sequence 1 26.20% 24.58% 24.72% 27.16%
GUACGACUCUUAGCGG 16 tRNA, AGT (Thr) tRNA tRF-Δ5T-Δ3AA 24.37% 19.51% 17.18% 32.54%
CCUGGAUGAUGAUAAGCAAAUGCUGACU 28 C/D box snoRNA, SNORD44/U44 snoRNA box C 18.02% 16.31% 27.18% 28.47%
GCCCGGCUAGCUCAGUCGGUAGAGCAUGAGACUC 34 tRNA, CTT (Lys) tRNA tRF-5A 17.80% 8.89% 24.82% 15.98%
UGAGCAUGUAGACAAAGGUAACACUGAAG 29 C/D box snoRNA, SNORD78/U78 snoRNA box D 17.68% 18.08% 20.05% 24.69%
GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUCCCACGCGGGAGACCCGGGU 52 tRNA, CCC (Gly) tRNA tRF-5T 15.24% 6.89% 11.55% 15.44%
AAUACAUGAUGAUCUCAAUCCAACUUGAACUCUCUCACUGAUUACUUGAUGACAAUAAAAUAUCUGAUA 69 C/D box snoRNA, SNORD81/U81/Z23 snoRNA box C, D, D’, guide sequence 1 14.77% 18.35% 12.49% 16.56%
UAUUGCACUUGUCCCGGCCUGUUA 24 Putative conserved non-coding region (RNAz) other n/a 13.01% 13.20% 15.07% 13.80%
GGCUGGUCCGAUGGUAGUGGGUUAUCAGAACU 32 hy4 Ro RNA Y RNA Ro60 binding region 11.65% 29.69% 15.19% 38.64%
GCAUUGGUCGUUCAGUGGUAGAAUUCUCGCCU 32 tRNA, CCC (Gly) tRNA tRF-5A 11.58% 16.71% 31.53% 58.67%
UCCACCACGUUCCCGUGG 18 Putative conserved non-coding region (RNAz) other n/a 9.42% 12.81% 18.59% 8.16%
GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGC 34 tRNA, GCC (Gly) tRNA tRF-5A 9.37% 6.50% 21.50% 20.20%
GCUUCUGUAGUGUAGUGGUUAUCACGUUCGCCU 33 tRNA, CAC (Val) tRNA tRF5A 9.04% 6.33% 19.65% 21.11%
GCAUUGUGGUUCAGUGGUAGAAUUCUCGC 29 tRNA, GCC (Gly) tRNA tRF-5A 6.58% 10.57% 15.96% 36.65%
GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGU 52 tRNA, GCC (Gly) tRNA tRF-5T 4.78% 5.57% 10.11% 21.10%
CCCCCCACUGCUAAAUUUGACUGa 23 hy4 Ro RNA Y RNA Ro60 binding region 4.03% 16.11% 5.51% 44.43%
  1. adifferentially accumulated at 96 hpi
  2. bnot applicable
\