Skip to main content

Table 2 Features of the 25 most abundant differentially accumulated representative RNA fragments

From: Small RNA fragments derived from multiple RNA classes – the missing element of multi-omics characteristics of the hepatitis C virus cell culture model

Sequence Length Parental RNA RNA class Fragment type log2FC 72 hpia log2FC 96 hpia Relative abundance
72C 72I 96C 96I
CCCCCCACUGCUAAAUUUGACUG 23 hy4 Ro RNA Y RNA Ro60 binding region 2.00 3.01 4.03% 16.11% 5.51% 44.43%
UCCCACAUGGUCUAGCGGUUAGGAUUCCUGGUU 33 tRNA, TTC (Glu) tRNA tRF-5A 2.14 2.43 2.10% 9.25% 2.76% 14.90%
UCCCUGGUGGUCUAG 15 tRNA, CTC (Glu) tRNA tRF-5D 3.04 1.41 0.27% 2.25% 0.86% 2.29%
UACGACUCUUAGCGGUGGAUCACUCGGC 28 ambiguous mapping (intergenic / rRNA) other n/ab 2.38 1.95 0.20% 1.03% 0.30% 1.16%
GCCCGGCUAGCUCAGUCGGUAGAGCAUGGGACUCUUAAUCCCAGGGUCGUGGGUU 55 tRNA, CTT (Lys) tRNA tRF-5T 1.03 2.40 0.48% 0.98% 0.44% 2.34%
GUUAAGAUGGCAGAGCCCGGUAAUCGCAUAAAACUUAAAACU 42 tRNA, TAA (Leu) tRNA tRF-5A 0.93 2.54 0.50% 0.96% 0.54% 3.13%
UUGGUCGUGGUUGUAGUCCGUGCGAGAA 28 tRNA, TTC (Glu) tRNA tRF-Δ5A-Δ3AA 1.36 4.32 0.34% 0.86% 0.26% 5.24%
GUUCGCGCUUUCCCCUG 17 U1 spliceosomal RNA snRNA no functional region 0.61 3.56 0.54% 0.83% 0.21% 2.46%
CGGCCACUGAUUAUCGAGGCGAUUCUGAUCUG 32 scaRNA, HBII-382/scaRNA2 scaRNA no functional region 0.80 2.62 0.46% 0.80% 0.57% 3.52%
CCCCACUGCUAAAUUUGACUG 21 hy4 Ro RNA Y RNA Ro60 binding region 2.63 3.70 0.12% 0.72% 0.25% 3.18%
ACUCGACUGCAUAAUUUGUGGUAGUGGGG 29 U1 spliceosomal RNA snRNA Sm binding 5.22 7.82 0.02% 0.58% 0.03% 7.43%
UAGGAUGGGGUGUGAUAGGUGGCACGGAGAA 31 ambiguous mapping (intergenic / tRNA) other n/a 1.38 3.55 0.21% 0.54% 0.17% 2.05%
CACAAAUGAUGAAUAACAAAGGGACU 26 C/D box snoRNA, SNORD82/U82 snoRNA box C 2.40 3.49 0.10% 0.53% 0.15% 1.72%
UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUCUCACC 39 tRNA, TTC (Glu) tRNA tRF-5A 1.62 2.60 0.17% 0.51% 0.22% 1.35%
GGUUAGCACUCUGGACUC 18 tRNA,CTG (Gln) tRNA tRF-Δ5D-Δ3A 3.02 2.46 0.06% 0.49% 0.11% 0.63%
UCGUACGACUCUUAGCGGUGGAUCACUCGGC 31 ambiguous mapping (intergenic / rRNA) other n/a 1.98 2.37 0.12% 0.46% 0.14% 0.74%
AAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACU 35 U1 spliceosomal RNA snRNA Sm binding 5.70 9.02 0.01% 0.40% 0.01% 5.00%
GUUAAGAUGGCAGAGCCC 18 tRNA, TAA (Leu) tRNA tRF-5D 2.07 2.31 0.09% 0.38% 0.22% 1.07%
GGUAAAAUGGCUGAGUGAAGCAUUGGACU 29 tRNA, GTA (Tyr) tRNA tRF-5A 1.33 2.65 0.14% 0.36% 0.17% 1.05%
ACUUUAGCUCUAGAAUUACUCUGAGACCU 29 C/D box snoRNA, SNORD45/U45 snoRNA box D, guide sequence 2 2.00 5.05 0.09% 0.35% 0.06% 2.14%
CUACGGGGAUGAUUUUACGAAC 22 C/D box snoRNA, SNORD26/U26 snoRNA box C 3.05 2.40 0.04% 0.35% 0.11% 0.58%
UCACCCGGCCCGGACACG 18 piRNA other n/a 5.07 8.18 0.01% 0.34% 0.01% 4.13%
AAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACU 43 U1 spliceosomal RNA snRNA Sm binding 8.36 9.93 0.00% 0.34% 0.00% 3.09%
AUUGGAAGACACUCUGCGACAGUG 24 H/ACA box snoRNA, ACA7/SNORA7/SNORA7A snoRNA box ACA, guide sequence 4 0.97 3.22 0.17% 0.33% 0.18% 1.64%
CACGCAUCGACCUGGUAUUGCAGUACCUCCAGGAACGG 38 U2 spliceosomal RNA snRNA no functional region 2.62 5.47 0.05% 0.31% 0.04% 1.78%
  1. adifferentially accumulated (log2FC ≥ 2 or ≤ −2 and FDR < 0.05; relative abundance sorted by 72I) are marked with boldtype
  2. bnot applicable
\