Skip to main content

Table 3 Features of the 26 representative RNA fragments with log2FC > 5a

From: Small RNA fragments derived from multiple RNA classes – the missing element of multi-omics characteristics of the hepatitis C virus cell culture model

Sequence Length Parental RNA RNA class Fragment type log2FC 72 hpib log2FC 96 hpib Relative abundance
72C 72I 96C 96I
AAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUG 36 U1 spliceosomal RNA snRNA Sm binding 5.14 11.59 0.00% 0.01% 0.00% 0.26%
AUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGA 40 U1 spliceosomal RNA snRNA Sm binding 7.27 11.33 0.00% 0.01% 0.00% 0.21%
AAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACU 43 U1 spliceosomal RNA snRNA Sm binding 8.36 9.93 0.00% 0.34% 0.00% 3.09%
ACCCCACGUCUCGUCGCG 18 FGF-2 internal ribosome entry site (IRES) other n/ac 6.54 9.45 0.00% 0.04% 0.00% 0.26%
GGUCCGCCGGCCCUG 15 Putative conserved non-coding region (EvoFold) other n/a 6.90 9.35 0.00% 0.05% 0.00% 0.27%
AAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACU 35 U1 spliceosomal RNA snRNA Sm binding 5.70 9.02 0.01% 0.40% 0.01% 5.00%
ACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUG 34 U1 spliceosomal RNA snRNA Sm binding 5.67 9.00 0.00% 0.19% 0.01% 2.55%
AUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGG 38 U1 spliceosomal RNA snRNA Sm binding 6.71 8.92 0.00% 0.25% 0.01% 2.89%
CUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGC 45 U1spliceosomalRNA snRNA no functional region 6.49 8.45 0.00% 0.07% 0.00% 0.93%
GAGUUCUGGGCUGUAGUGCGCU 22 7S RNA other n/a 4.67 8.33 0.00% 0.06% 0.00% 0.29%
UGGGCAGGAGAUGCCGUGGACCCC 24 Nuclear RNase P other n/a 5.22 8.18 0.00% 0.03% 0.00% 0.29%
UCACCCGGCCCGGACACG 18 piRNA other n/a 5.07 8.18 0.01% 0.34% 0.01% 4.13%
GGGACUGACCUGAAAUGAAGAGAAUACU 28 C/D box snoRNA, SNORD2/snR39B snoRNA box D’ 4.20 7.88 0.00% 0.02% 0.00% 0.30%
ACUCGACUGCAUAAUUUGUGGUAGUGGGG 29 U1 spliceosomal RNA snRNA Sm binding 5.22 7.82 0.02% 0.58% 0.03% 7.43%
AUUGCACUCCGGAUGUGCUGACCCCU 26 U1 spliceosomal RNA snRNA no functional region 4.88 6.87 0.00% 0.06% 0.00% 0.46%
AUUGCACUCCGGAUGUGCUGACCCCUGCGAUUUCCCCAAAUGUGG 45 U1 spliceosomal RNA snRNA no functional region 4.21 6.49 0.00% 0.04% 0.00% 0.26%
UCACCCGGCCCGGAC 15 piRNA other n/a 5.02 6.31 0.01% 0.25% 0.02% 1.76%
ACCCAGGCGGCCCGGGUUCGACUCCCGGUGUG 32 tRNA, TTC (Glu) tRNA tRF-Δ5A-Δ3AA 5.62 6.14 0.00% 0.04% 0.00% 0.30%
GCGCGCCGGCCGGGCG 16 Putative conserved non-coding region (EvoFold) other n/a 4.26 5.69 0.01% 0.26% 0.04% 1.89%
UUUUACGGAUCUGGCUUCUGAGA 23 C/D box snoRNA, SNORD50/U50A snoRNA box D, guide sequence 1.36 5.65 0.03% 0.07% 0.01% 0.57%
CACGCAUCGACCUGGUAUUGCAGUACCUCCAGGAACGG 38 U2 spliceosomal RNA snRNA no functional region 2.62 5.47 0.05% 0.31% 0.04% 1.78%
UAGCUCUAGAAUUACUCUGAGACCU 25 C/D box snoRNA, SNORD45/U45 snoRNA box D 0.90 5.30 0.03% 0.05% 0.01% 0.31%
AUACAUGAUGAUCUCAAUCCAACUUGAACUCU 32 C/D box snoRNA, SNORD81/U81/Z23 snoRNA box C 2.82 5.13 0.01% 0.06% 0.01% 0.34%
AAUCUGUAGUCUUGGAGCCGCACAGGGUUGGUGGUACCCUCG 42 scaRNA, scaRNA13/U93 snoRNA no functional region 1.72 5.11 0.03% 0.11% 0.02% 0.85%
ACUUUAGCUCUAGAAUUACUCUGAGACCU 29 C/D box snoRNA, SNORD45/U45 snoRNA box D, guide sequence 2.00 5.05 0.09% 0.35% 0.06% 2.14%
AGAAAUAUGUCUGAUAAAAGAUUUACUUUGAUAGAGUAAAUAAUAGGAGCU 51 tRNA, GAT (Ile) tRNA tRF-5T 1.47 5.00 0.02% 0.07% 0.01% 0.33%
  1. aat least at 96 hpi (FDR < 0.05; sorted by log2FC at 96 hpi)
  2. bdifferentially accumulated are marked with boldtype
  3. cnot applicable
\