Skip to main content

Table 2 Information of the primers used in this study

From: Identification and characterization of long non-coding RNAs in subcutaneous adipose tissue from castrated and intact full-sib pair Huainan male pigs

Loci Primer senquence Size Primer Efficiency
Forward (5′-3′) Reverse (5′-3′) (bp) (mean ± SE)
TCONS_00311264 TGTGGAGGAAACGAGGGT GAAAGATGCCGCTTGGA 224 0.95 ± 0.01
TCONS_00392681 TATTCTGGGCAGGATTG GCAGGTCTTTCGAGGTA 160 0.97 ± 0.04
TCONS_01199263 CTCGCTCAACTCAGCATTC TGGACAAGGGTTAGAAGTAAAT 228 0.84 ± 0.04
TCONS_01743394 TATTGAAATGCGTGAGGCT CTGGAACGAGCAAGGAGA 187 0.88 ± 0.02
TCONS_00465264 GCTGCGCTCTATTCTGTG GTATGCCAGGAGGGAGGA 121 0.86 ± 0.02
TCONS_00625772 GGCTTCCGCCTCGTTGAT CTGGCTGCCTTCGTTTCC 122 0.94 ± 0.06
TCONS_00869992 AGGGAGAAGGAGTGAGACAAG GGGAAGGCAGATGGACAA 174 0.92 ± 0.03
TCONS_01520466 TTTCTTGGGTAAACATCTGG GTGACCTTGTTGGGCAGT 158 0.87 ± 0.05
NR2F2 GGACCACATACGGATCTTC CTGGCTCCTAACGTACTCTT 190 0.94 ± 0.04
ENSMUSG00000100005 GATTAGAGTATCGCATCAGC CGTGGGTCAGCAAGGTTA 296 0.95 ± 0.02