Skip to main content

Advertisement

Table 2 Positions in the sorghum genome and primer sequence of the 16 single nucleotide polymorphisms (SNPs) chosen for PCR amplification and subsequent Sanger sequencing validation (Chr = Chromosome)

From: Mining sequence variations in representative polyploid sugarcane germplasm accessions

Code SNP type Callera Chr. Forward sequence Reverse sequence
SNP1 T/A F, G, Sa, St, T 2 ACGTCAAAAGCTTCGCAGGA GGCAAAGAAAGCACTGAAGG
SNP2 C/T F, G, Sa, St, T 2 GCCTGAGATGGCACAAAAAT CACTGTTTTGCATCCTTTGC
SNP3 G/A F, G, Sa, St, T 3 CACCACCCACCAACCTAAGC TTCTTTGCAGTGACCCAGTG
SNP4 A/T T 3 GGAAGGGCAAGGACTCCTAC GAAGCCCAGGGACATTGTTA
SNP5 T/C F, G, Sa, St, T 3 GCTCGCTACAGGGCATAAAG ACCGTGGTGCTTTTAGAGCT
SNP6 T/C F, G, Sa, St, T 3 GGGAACCAAAAAGGAGGGTA GCATACCCTCAAAGGAGTTG
SNP7 C/T F, G, Sa, St, T 4 GCTCCCAAAGACCATGACAG TGTCGTGCAGAAGCCAATTA
SNP8 G/A F, G, Sa, St, T 4 GCTCCCAAAGACCATGACAG TGTCGTGCAGAAGCCAATTA
SNP9 G/A F, G, T 4 CATCCTGGTTTTCAGGGGTA TTGCGGAGGATATGCAGAGT
SNP10 A/G F, G, Sa, St, T 5 ATGAACGCTTTCCAGATGCT TCTCACCTGGTGCTCCTTCT
SNP11 C/T G, Sa, St, T 5 TCAGCCTGGTGAGTTTCCTT TGTAAACTGGGGAGGACCAG
SNP12 C/T T 5 TGCAGGTGCTTGCTGAGTAT AAGCAAGATTGTGCCCTTCA
SNP13 C/A F, G, Sa, St, T 5 TCTGGATGGGGTACTGGGTA CCCGGCTAAAGACAATACGA
SNP14 A/G F 6 CCTGTCCTTAGTGTCTGCAT CAAGCAAGCAAGTTCCCATT
SNP15 C/T F, G, Sa, St, T 6 CCTGTCCTTAGTGTCTGCAT CAAGCAAGCAAGTTCCCATT
SNP16 G/A F, G, T 6 AAAACATTGAAAGCAGATGC GCATGTGGCATGTAATGAGG
  1. aSNPs were called by reference-based callers: F Freebayes, G GATK, Sa Samtools, St Stacks, T Tassel