Skip to main content

Table 1 Significant Differences in miRNA expression between Passages [P3, P5, P7]

From: MicroRNA expression in bone marrow-derived human multipotent Stromal cells

# miRNA Name Sequence P5/P3 P5/P3 P7/P3 P7/P3
Adjusted Fold Adjusted Fold
p-value Change p-value Change
1 hsa-miR-196b-5p CCCAACAACAGGAAACTAC 0.0294 −1.05 0.0231 −1.05
2 hsa-miR-16-5p CGCCAATATTTACGTGCTG 0.0464 −1.33 0.0334 −1.39
3 hsa-miR-1202 CTCCCCCACTGC 0.0294 1.39 0.0334 1.32
4 hsa-let-7 g-5p AACTGTACAAACTACTACCT 0.0049 −1.19 0.0161 −1.15
5 hsa-miR-572 TGGGCCACCGCCG 0.0385 1.24 0.0335 1.26
6 hsa-miR-92a-3p ACAGGCCGGGACAAGT 0.0334 −1.21 0.0385 −1.19
7 hsa-miR-638 AGGCCGCCACCCG 0.0464 1.28 0.0232 1.45
AGGCCGCCACCCGC 0.0385 1.38 0.0310 1.49
8 hsa-miR-1915-3p CCCGCCGCGTC NS NS 0.0385 1.32
9 hsa-miR-17-5p CTACCTGCACTGTAAGC NS NS 0.0335 −1.22
10 hsa-miR-29b-1-5p TCTAAACCACCATATGAAACCAG NS NS 0.0380 −1.13
11 hsa-miR-15b-5p TGTAAACCATGATGTGCTG NS NS 0.0335 −1.42
  1. NS Not Significant
  2. A repeated measures ANOVA was performed on the 6 MSC donors that grew to passage 7. Positive fold change indicates upregulation in MSC expression at passage 7, while negative fold change indicates downregulation in MSC expression at passage 7