Skip to main content

Table 1 Primers used for real-time PCR validation

From: The purplish bifurcate mussel Mytilisepta virgata gene expression atlas reveals a remarkable tissue functional specialization

target gene forward primer (5′ - > 3′) reverse primer(5′ - > 3′)
Chitotriosidase TACTGCGATTGGCCATACAA TGCCTGTGTAGTTCGAGGTG
Meprin A GCTTGGGTACATCGACCACT CTGCTTTGGTTCCAGTGTCA
Paramyosin CCGAACTCGCAGAAAAGAAC CGTAGAGCTTCCTCGGTGTC
Myosin, striated muscle CTCTTGTTGCCCCAGGATTA CTGGTAGCTCCACCAGCTTC
Acetylcholine receptor GTCAAAGTCGGCCACTCACT GTCTGACCGTCGTTGGTTCT
Glycine-rich secreted protein CACACGGTCTTACTGGAGCA GTTCGCCTTGTTCACCTTGT
Valine-rich secreted protein AAAGTGCCATTCGAGACACC GGGCTGGGAACTCTGAATTT
SCP domain containign protein TCAAACACTGCGTCAAGACC GGATCCACGTTTTCTCTTGC
Serine protease inhibitor AGGCCAACTGCAAAAACG CCGTCAACTCCACACACG
Tyrosinase-like protein 2 CAGAGCCCTACCTCCAGATG TGACTGCTCGCTTTGTATGG
EF1alpha CTCTTCGTCTCCCACTCCAG ACCAGGGAGAGCTTCAGTCA
Ribosomal protein S2 GCCATTGCCAATACCTATGC GCCTGGTTGACGAGTATGGT