Skip to main content

Table 1 Top 30 significantly DE miRNAs and their predicted target genes from microarray analysis in PMECs at 3 hpc with E. coli compared with unchallenged controls

From: MicroRNA expression profiling of porcine mammary epithelial cells after challenge with Escherichia coli in vitro

3 hpc with E. coli   
Upregulated miRNA Sequence (5′ - > 3′) Downregulated target genes
 miR-29b UAGCACCAUUUGAAAUCAGUGUU BCOR, KLHDC7A
 miR-140 CAGUGGUUUUACCCUAUGGUAG RAB40B
 miR-210 UUGUGCGUGCGACAGCGACUUC RAB40B
 miR-101 UACAGUACUGUGAUAACUGAAG EML5, HELLS, RBM12
 miR-29a UAGCACCAUUUGAAAUCGGUU CDC6, CYP26A1, DNAJA1, EML5, RNF2, TIMM44
 miR-24-star GUGCCUACUGAGCUGAUAUCAGU USP46
 miR-30b-star CUGGGAGGUGGAUGUUUACUUC BCOR
 miR-B6 AAGUGCCCGACGCGGGGAACGUG ENC1
 let-7 g-star CUGUACAGGCCACUGCCUUGC DUSP6
 miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC ARID5B, ID4, ITGB8, KIAA0182, NUAK1, PHF17, RAB40B, TOX, USP2, VGLL3, WDR35
Downregulated miRNA Sequence (5′ - > 3′) Upregulated target genes
 miR-371 ACUCAAAAAAUGGCGGCACUUU SGSM1
 miR-548u CAAAGACUGCAAUUACUUUUGCG NFKBIA
 miR-5128 CAAUUGGGGCUGGCGAGAUGGCU SGSM1
 miR-8-5p CAUCUUACCGGGCAGCAUUAGA ARHGAP28, HIVEP2, IFNAR2
 miR-259-star CCACCGAUUUGGCAUGGGAUUGAC SGSM1
 miR-3277 UGGGCAUGUUUCUGAAAUUCGAU ARHGAP28, IFNAR2, IL1A, PPARG
 miR-4903 UACCCCGGUAGGCAUAGGUUG GLRX, IL1RAP, MAP3K8, PLAUR
 miR-202 AGAGGCAUAGGGCAUGGGAAAA ARHGAP28, CHL1, GLI3, HIVEP2, IFNAR2, JAG1, LIFR, MAP3K8, OSBPL3, P2RX4, RFFL, RMND5A, RNF19B, TEP1, TNFAIP3, TPM2, VPS37C, YPEL2
 miR-5100 UCGAAUCCCAGCGGUGCCUCU OBFC1
 miR-2287 CUGGGACUGGUGGCAGCACUU CLDN1, ITGAV, RNF19B
 miR3949 UGAUGUUGAGGCAAAAAUGUAG CCDC152, RBM39, RFX1
 miR-885-3p AGGCAGCGGGGUGUAGUGGAUA BIRC3, DCUN1D3, HIVEP2, IL10RB, MAP3K8, TNFAIP3
 miR-2518 UCGAGCAGCGGGUCGAUCCGAGC CYP1A1, JAG1
 miR-3042 GAGGGCAGAUUAUUUCUGAUAC JAG1, LPIN1, YPEL2
 miR-4031-5p CCCAAAGUGUCGGCGCAUAU SGSM1, TNFAIP3
 miR-4317 ACAUUGCCAGGGAGUUU NFKBIA
 miR-216b AAAUCUCUGCAGGCAAAUGUGA ETV5, PDLIM5
 miR-890 UACUUGGAAAGGCAUCAGUUG EHF, FCHSD2, IL10RB, PLXND1, SGSM1, SLC4A7, TAP1
 miR394b-star AGGUGGACAUAUUGCCAACA ITGAV, JAG1
 miR-648 AAGUGUGCAGGGCACUGAU HIVEP2, IFNAR2, JAG1, SGSM1
  1. MiRNAs with p < 0.05 and fold change >1.5 or < −1.5 are listed and sorted by fold change in descending order. TargetScan-predicted miRNA-mRNA pairs showing negative correlation in expression profile and energy-value of at least −25 kcal/mol