Table 1 List of the primers used for assessment of the INDEL events differentiating the two B. suis biovar 2 clonal lineages
From: Evolution and genome specialization of Brucella suis biovar 2 Iberian lineages
INDEL | Primer sequence 5′ → 3’ | Chr | Amplified region in ATCC 23445 | Affected CDS in ATCC 23445 | PCR product expected size (bp)a | ||
|---|---|---|---|---|---|---|---|
CECL | ICL | ||||||
SI79506 | F R | tgcacacgtagggtcgata cacccagatgttcggctat | I | 79,420..80357 | BSUIS_A0075 | 938 | 260 |
SI1356057 | F R | taggctgcctggaattcatc cggcaagttcacctctgact | I | 1,355,436..1356288 | Intergenic | 853 | 765 |
SI1423448 | F R | tttcttattccacccgatcc caaaatgttactgcgtgaagc | I | 1,423,358..1423655 | Intergenic | 298 | 298 (218) |
SI1627485 | F R | caatccacaggagatcggt gcttcacgggtatcatgtaca | I | 1,627,421.. 1,627,600 | BSUIS_A1714 | 180 | 129 |
SI2041144 | F R | tcggaaatggacgaatatca ttcttgtcgtcggaaatgtc | II | 107,306..107533 | Intergenic | 228 | 228 (171) |
SI2603410 | F R | agtggattttggtgcgtttc aagatgagcgggaaatgttg | II | 679,423..680774 | BSUIS_B0700; BSUIS_B0701 | 1352 | 508 |
LI3234619 | F R | tattattcactttgagcggca aactgcaaaagcttggctg | II | 1,310,801..1312970 | BSUIS_B1354-BSUIS_B1357 | 2170 | 174 |