Skip to main content

Table 2 Known miRNAs with significantly differential expression in sugarcane buds following cold treatment

From: miRNA alteration is an important mechanism in sugarcane response to low-temperature environment

miRNA sequence F0-std F3-std R0-std R3-std Fold change
F0-F3 R0-R3
miR1310 GAGGCATCGGGGGCGCAACGCC 8.32 29.24 15.78 30.98 1.81** 0.97
miR1520d ATCAGAACTGGTACGGACAA 574.08 1917.98 1131.16 2620.83 −1.74** 1.21
miR157a TTGACAGAAGATAGAGAGCAC 4.65 9.68 4.34 4.26 1.06** −0.02
miR2199 TGATAACTTGACGGATCGC 59.42 179.46 129.61 272.82 1.59** 1.07**
miR2916 GGGGCTCGAAGACGATCAGAT 46.30 198.06 128.65 255.78 −2.10** 0.99
miR5054 TCCCCACGGACGGCGCCA 50.00 117.65 81.84 164.77 1.23** 1.00**
miR5059 CGTTCCTGGGCAGCAACACCA 35.92 97.80 84.02 201.88 1.44** 1.26**
miR5072 GTTCCCCAGCGGAGTCGCCA 2.16 7.70 5.34 20.97 1.82** 1.97**
miR5077 TTCACGTCGGGTTCACCA 104.90 321.31 104.90 321.30 1.62** 1.62**
miR5152-3p AGTCCTGCTATACCCACCA 0.59 2.02 1.30 3.76 1.77** 1.52**
miR5575 TGGATTTTGGAATGTTTTGGT 0.39 1.98 3.03 2.23 2.32** −0.44
miR5671 CATGGTGGTGACGGGTGAC 32.73 70.96 72.74 126.88 1.12** 0.80
miR5813 ACAGCAGGACGGTGGTCATGGA 63.41 206.30 132.57 269.48 1.70** 1.02**
miR6196 GGGACGAGAAAGATGGGAGGA 5.12 11.12 17.93 21.15 1.12 1.09**
miR6300 GTCGTTGTAGTATAGTGGTG 101.38 217.53 216.10 284.36 1.10** 0.40
miR6478 CCGACCTTAGCTCAGTTGGTA 14.70 32.52 30.53 51.46 1.14** 0.75
miR8155 CGTAACCTGGCTCCGATACCA 4.14 9.20 8.10 16.96 1.15** 1.06**
miR894 GTTTCACGTCGGGTTCACCA 334.04 1108.12 1040.41 2131.64 1.72** 1.03
miR160a TGCCTGGCTCCCTGTATGCCA 13.92 4.43 4.64 8.89 −1.65** 0.94
miR169b CAGCCAAGGATGACTTGCCGG 43.54 20.76 38.28 39.38 −1.06** 0.04
miR169e-3p GGCAGTCTCCTTGGCTAGC 73.19 31.02 14.24 21.84 −1.24** 0.62
miR397-5p TTGACTGCAGCGTTGATGAGC 9.82 12.34 2.30 3.64 1.12** 0.66
miR528-5p TGGAAGGGGCATGCAGAGGAG 123.62 49.19 303.86 262.15 −1.32** −0.21
miR5532 ATGGAAATTGATGACAAAGGGG 1.58 0.77 1.46 1.20 −1.03 * −0.28
miR1861d TGCGTCATCAGGCAGGAACTGG 3.30 15.34 2.22**
miR395o-3p TGAAGTGTTTGGGTGAACTC 2.60 1.64 0.88 2.56 −0.66 1.54**
miR5221 AACGAGATGGTGTTTTACTT 3.00 14.23 2.24**
miR5242 TATTTAGAACAGGCGATGTCA 1.26 1.49 3.68 13.24 0.24 1.84**
miR5272f GAATTGATTTGTGTTGGATAAATT 3.27 2.64 0.80 1.78 −0.30 1.14**
miR394a TTGGCATTCTGTCCACCTCC 4.26 7.78 0.88 0.74 1.03** −0.96
miR863-5p TTATAGTCTTGTGGATCAAAT 0.23 1.53 2.73**
  1. F0 and F3 represent the bud sample from sugarcane cultivar FN39 with 0 h and 3 h cold (4 °C) treatment, respectively, while R0 and R3 represent the similar samples from cultivar ROC22, respectively. ** and * indicate a significant difference at p-value <0.01 and p-value <0.05, respectively. “---” indicates no expression