Skip to main content

Table 3 Novel miRNAs with significant differential expression in sugarcane buds following cold treatment

From: miRNA alteration is an important mechanism in sugarcane response to low-temperature environment

miRNA sequence F0-std F3-std R0-std R3-std Fold change
F3-F0 R3-R0
novel_mir_107 AGGGATGGTATGCACTGAAGC 0.01 3.71 0.01 4.55 8.54** 8.83**
novel_mir_117 AAGAGGAAGAGAGAGAGGGTG 0.01 0.01 0.01 12.33 10.27**
novel_mir_134 GAGGCAAGGAGGTGGAATAGAC 0.01 3.90 8.61**
novel_mir_136 AAGCAAGTTGGGGTAGGCTAA 0.01 1.30 7.02**
novel_mir_142 TGAAACGGTACGGCTGATAAGTT 0.01 1.06 6.73**
novel_mir_21 TAAATATATAACATCAGGACC 1.10 0.01 −6.79**
novel_mir_34 CGTACCACCGTCCGGGACTAA 1.14 0.01 −6.84**
novel_mir_37 TCCAATGCATACCGTCCCTAA 3.94 0.01 5.03 0.01 −8.62** −8.97**
novel_mir_41 CCGAGAGGTAGGGCCGGTCGAA 6.55 0.01 12.83 10.34 −9.35**
novel_mir_54 TCCAAATTATAAGACGTTTTG 1.03 0.34 1.57 0.79 −1.60** −1.00 *
novel_mir_57 GGGCTGGTTCGGCTGGTGGAA 1.10 0.01 −6.79**
novel_mir_68 ATAAGACGTTTTGGCTTTTCT 3.90 0.01 −8.61**
novel_mir_72 AAGAGGAAGAGAGAGAGGGTGA 16.09 0.01 16.17 0.01 −10.65** −10.66**
novel_mir_74 TCTTGGATTTGCATTGGATGCC 1.18 0.01 −6.89**
novel_mir_79 CGGCCGACGCGCCGCGGCGGGC 2.64 0.01 2.19 0.01 −8.05** −7.77**
novel_mir_80 TGGTTGTTGGCTGGCCATGGCTG 5.44 5.93 6.57 0.01 −9.36**
novel_mir_81 GCTAGAGGCAGCAACTGCATA 9.94 0.01 −9.96**
novel_mir_89 CAATCGTGGACCAACTAGGCT 4.85 0.01 3.53 4.01 −8.92** 0.18
novel_mir_91 CCTGCGTCGCACGGATTCGT 1114.45 3231.35 1.54**
novel_mir_97 GTCGTCGCCGTCGTCGTCGTC 1.10 0.34 1.19 0.79 −1.71** −0.60
novel_mir_1 GGAATGTTGTCTGGTCGGAGA 9.31 7.37 10.48 0.01 −0.34 −10.03**
novel_mir_130 GGCATGGGAACATGTAGGAAGG 0.01 2.81 8.14**
novel_mir_171 TTTGAATAAGACGAGTGGTCA 10.33 0.01 −10.01**
novel_mir_183 TAAGCTGGCTGATGCTGTTTT 1.65 0.01 −7.37**
novel_mir_216 TCGAGGCCGAACGGATAAGTC 0.01 1.53 7.26**
novel_mir_228 TTTTTGGTGATTGATGACAAC 0.01 2.90 8.18**
novel_mir_28 AGGTCATGCTGTAGTTTCATC 1.30 3.02 1.21**
novel_mir_3 GGCTGAGCATGCCGCCGTCGAG 0.75 1.49 7.18 2.40 1.00 −1.58**
novel_mir_58 CGTCGCCGTCGTCGTCGTCGTC 2.29 1.64 1.11 0.50 −0.48 −1.16 *
novel_mir_64 AGGGGTTGTGCGGCGGTGCCC 1.42 0.01 −7.15**
novel_mir_67 AAAAACTTTGTACTAAAGCATA 2.27 0.01 −7.82**
  1. F0 and F3 represent the bud sample from sugarcane cultivar FN39 with 0 h and 3 h cold treatment, respectively; R0 and R3 represent the bud sample from sugarcane cultivar ROC22 with 0 h and 3 h, respectively. ** and * indicate a significant differences at p-value <0.01 and p-value <0.05, respectively. “---” indicates no expression