Skip to main content

Table 2 Primers used for validation of microarray analysis by RT-qPCR

From: Early nutritional programming affects liver transcriptome in diploid and triploid Atlantic salmon, Salmo salar

Genes Primer sequence (5′-3′) Amplicon Ta Accession number Reference
cpn2 F: AAGGATGGAGAGCTGCTGTT 154 bp 59 °C XM_014180427.1 New design
R: CTATCCCTCCGGTGAAGTCC
gsta3 F: ACCTCCCTGTGTTCGAGAAG 231 bp 59 °C NM_001140755.1 New design
R: CGTCATCAGGTTGAGGCTTC
hspa4 F: CTACGCTGTGGAAATCGTGG 242 bp 59 °C XM_014136794.1 New design
R: CACTTAACCCCTCCTCTGCA
hspa5 F: CTACGCCTACTCGCTCAAGA 166 bp 59 °C XM_014136127.1 New design
R: CTCCTTCTTCTTGGCCTGGA
tryp F: GATACATGGACGGAGGCAGA 210 bp 59 °C NM_001140895.2 New design
R: ACAGGGAGGAAAGCAGCTAG
elovl5b F: ACAAAAAGCCATGTTTATCTGAAAGA 141 bp 60 °C NM_001136552.1 Betancor et al. [63]
R: AAGTGGGTCTCTCTGGGGCTGTG
elovl6 F: ATCTGAGGAAACCGCTGGTG 177 bp 56 °C XM_014199191.1 New design
R: CAAAGGCGTAGGCCCAAAAC
fads2d6a F: GCTGGCCCATCTAGCAGAAA 119 bp 59 °C NM_001123575.2 New design
R: TGTCTGAGCCAAGTCACACC
βactin F: ATCCTGACAGAGCGCGGTTACAGT 112 bp 60 °C AF012125 McStay et al. [64]
R: TGCCCATCTCCTGCTCAAAGTCCA
ef1a F: CACCACCGGCCATCTGATCTACAA 78 bp 60 °C DQ834870 Ytteborg et al. [65]
R: TCAGCAGCCTCCTTCTCGAACTTC
rpl1 F: ACTATGGCTGTCGAGAAGGTGCT 120 bp 60 °C NM_001140826.1 Carmona-Antoñanzas et al. [66]
R: TGTACTCGAACAGTCGTGGGTCA
  1. cpn2 calpain-2, gsta3 glutathione S-transferase alpha 3, hspa4 heat shock protein 4-like, hspa5 heat shock protein 5-like, tryp trypsin, elovl5b fatty acyl elongase 5 isoform b, elovl6 fatty acyl elongase 6, fads2d6a delta-6 fatty acyl desaturase isoform a, βactin β-actin, ef1a elongation factor 1 alpha, rpl1 ribosomic protein L1