Skip to main content

Table 2 Primer list and sequences of 12 candidate reference genes for real-time PCR

From: A tissue-based approach to selection of reference genes for quantitative real-time PCR in a sheep osteoporosis model

Gene name Gene product Function Accession number Primer sequence Primer efficiency
GAPDH
(98 bp)
Glyceraldehyde 3-phosphate dehydrogenase Enzyme of glycolysis NM_001190390.1 F:5’ ACAGTCAAGGCAGAGAACGG 3′
R:5’ CCAGCATCACCCCACTTGAT 3’
97.0%
ALAS1
(123 bp)
Delta-aminolevulinate synthase 1 Enzyme of heme biosynthetic pathway XM_004018407.3 F:5’ CACTGCCCCAGTCACATCAT 3′
R:5’ GGGCACTGTGGGGTAATTGA 3’
95.5%
HPRT
(102 bp)
Hypoxanthine-guanine phosphoribosyl-transferase Enzyme of purine salvage pathway XM_015105023.1 F:5’ TTCTTTGCCGACCTGTTGGA 3′
R:5’ TCACCTGTTGACTGGTCGTT 3’
92.5%
EF-2
(106 bp)
Elongation factor 2 required for the translocation step in protein synthesis XM_012178077.2 F:5’ GTTGTGAAGGCCTACCTCCC 3′
R:5’ GCCAGTGGTCAAACACACAC 3’
99.5%
G6PDH
(106 bp)
Glucose-6-phosphate dehydrogenase Enzyme of pentose phosphate pathway NM_001093780.1 F:5’ ATTGTGGAGAAGCCCTTCGG 3′
R:5’ GGTAGTGGTCGATGCGGTAG 3’
94.5%
ACTB
(95 bp)
Beta-actin Cytoskeletal structural protein NM_001009784.2 F:5’ GCAGATGTGGATCAGCAAGC 3′
R:5’ GGGTGTAACGCAGCTAACAG 3’
92.0%
RPL19
(126 bp)
Ribosomal protein L19 Ribosomal protein XM_004012836.2 F:5’ AGCCTGTGACTGTCCATTCC 3′
R:5’ ACGTTACCTTCTCGGGCATT 3’
99.0%
B2M
(91 bp)
Beta-2 microglobulin Beta-chain of MHC-I NM_001009284.2 F:5’ CCTTGGTCCTTCTCGGGCTG 3′
R:5’ TCTGGCGGGTGTCTTGAGTAT 3’
98.5%
YWHAZ
(124 bp)
Tyrosine 3-monooxygenase/ tryptophan 5-monooxygenase activation protein, zeta Signal transduction NM_001267887.1 F:5’ GATGAAGCCATTGCTGAACTTGA 3′
R:5’ CAGCTTCGTCTCCTTGGGTA 3’
97.0%
SDHA
(104 bp)
Succinate dehydrogenase Enzyme of mitochondrial respiratory chain XM_012097183.1 F:5’ GAGTTCGTGCAGTTCCACCC 3′
R:5’ CTCTCACCCTGGCTGTTGAT 3’
91.5%
PGK1
(104 bp)
Phosphoglycerate kinase 1 Enzyme of glycolysis NM_001142516.1 F:5’ CCTCTGGCATACCTGTTGGC 3′
R:5’ CACCCACAGGTCCATTCCAC 3’
92.5%
TFRC
(96 bp)
Transferrin receptor Transmembrane glycoprotein XM_004003001.2 F:5’ ACCTCAAATCAGCGCTGTCA 3′
R:5’ CAGCCTCACGTGGGACATAA 3’
93.5%