Skip to main content

Table 1 Primer sequences and fragment size of Cashmere goat VIM gene and β-actin

From: Expression of Vimentin in hair follicle growth cycle of inner Mongolian Cashmere goats

Gene Name GenBank number Sequence of primer Products size
VIM XM_005688054.1 F: TTTCTCCACGCCTCCAGTT
R: ATGTCTTCGGCCAGGTTGT
296 bp
β-actin NM_001009784.1 F: GGCAGGTCATCACCATCGG
R: CGTGTTGGCGTAGAGGTCTTT
158 bp