Skip to main content

Table 2 Genes and primers used in qRT-PCR assay

From: Transcriptome profiling of lentil (Lens culinaris) through the first 24 hours of Ascochyta lentis infection reveals key defence response genes

Target gene Gene function Primer sequences (5’-3’) Amplification efficiencya Tm (°C)
DELLA SAR signalling F: GTCTTCTAATTCAAACCA 1.926 ± 0.027 53
   R: ATATCTGTTTACCCAAGTAA   
RBP-hnRNP Transcriptional factor F: GAGAAAGATATTTGTTGGAG 1.947 ± 0.024 51
   R: TGATCGTACATTACTACAACA   
PGIP Anti fungal compound F: TGAAGGTGATGCTTCTATGCT 2.013 ± 0.026 53
   R: GACTCACATCCAACGTTGCT   
PR2 Anti fungal compound F: GGCATGCTGGGAAACAATCT 2.018 ± 0.023 52
   R: TGGCACACCTAACATGAGCT   
PR10 Anti fungal compound F: TGGCACTTCTGCTGTTAGATGGAC 2.017 ± 0.083 50
   R: GGTAATCCATCCAGCCATTTGGAG   
PP2A Reference gene F: GCCTCATTTGCAGCTGGTTT 2.002 ± 0.025 53
   R: TACTCTCGTTCTAGGGTCCT   
  1. aMean and standard deviation of the amplification efficiency for each gene were calculated from the coefficients of linear regression models fitted to each reaction (value of 2 equivalents to 100% efficiency, see [43])