Skip to main content

Advertisement

Table 1 miRNA primers used for validation of microarray results (Exiqon, Denmark)

From: Breed-dependent microRNA expression in the primary culture of skeletal muscle cells subjected to myogenic differentiation

miRNA Primer Target sequence Accession (Exiqon)
hsa-miR-1 LNA™ PCR primer set, UniRT UGGAAUGUAAAGAAGUAUGUAU MIMAT0000416
bta-miR-9-5p LNA™ PCR primer set, UniRT UCUUUGGUUAUCUAGCUGUAUG MIMAT0009389
hsa-miR-128-3p LNA™ PCR primer set, UniRT UCACAGUGAACCGGUCUCUUU MIMAT0000424
hsa-miR-133a-3p LNA™ PCR primer set, UniRT UUUGGUCCCCUUCAACCAGCUG MIMAT0000427
hsa-miR-139-5p LNA™ PCR primer set, UniRT UCUACAGUGCACGUGUCUCCAGU MIMAT0000250
hsa-miR-145-5p LNA™ PCR primer set, UniRT GUCCAGUUUUCCCAGGAAUCCCU MIMAT0000437
hsa-miR-206 LNA™ PCR primer set, UniRT UGGAAUGUAAGGAAGUGUGUGG MIMAT0000462
hsa-miR-486-5p LNA™ PCR primer set, UniRT UCCUGUACUGAGCUGCCCCGAG MIMAT0002177
cfa-miR-503 LNA™ PCR primer set, UniRT UAGCAGCGGGAACAGUACUG MIMAT0006746
bta-miR-660 LNA™ PCR primer set, UniRT UACCCAUUGCAUAUCGGAGCUG MIMAT0004344
U6 snRNA LNA™ PCR primer set, UniRT (reference RNA) GUGCUCGCUUCGGCAGCACAUAU ACUAAAAUUGGAACGAUACAGAG AAGAUUAGCAUGGCCCCUGCGCA AGGAUGACACGCAAAUUCGUGAA GCGUUCCAUAUUUUU without MIMAT #