Skip to main content

Table 2 MiRNAs varying in expression in primary cultures of skeletal muscle cells isolated from semitendinosus muscle of both beef breed bulls (HER and LIM), when compared with the dairy breed (HF; the reference)

From: Breed-dependent microRNA expression in the primary culture of skeletal muscle cells subjected to myogenic differentiation

No. Systematic name p (Corr) FC (HER vs. HF) Log FC (HER vs. HF) Regulation (HER&LIM vs. HF) FC (LIM vs. HF) Log FC (LIM vs. HF) Active Sequence miRBase Accession No.
1 bta-miR-139 3.07E-13 123.08 6.94 up 126.11 6.98 ACTGGAGACACGTGC MIMAT0003788
2 bta-miR-2469 1.07E-03 83.81 6.39 up 11.25 3.49 AAGCCGCAGGCCC MIMAT0012059
3 bta-miR-486 2.06E-03 51.74 5.69 up 35.07 5.13 CTCGGGGCAGCTCA MIMAT0009329
4 bta-miR-2439-3p 6.58E-03 31.43 4.97 up 7.98 3.00 TCTGCCTACCTGTCTTC MIMAT0012014
5 bta-miR-449a 4.82E-02 21.21 4.41 up 10.53 3.40 ACCAGCTAACAATACACTGC MIMAT0009320
6 bta-miR-503-5p 1.26E-02 15.69 3.97 up 15.71 3.97 CAGTACTGTTCCCGC MIMAT0025557
7 bta-miR-1 1.87E-06 12.44 3.64 up 14.67 3.87 ATACATACTTCTTTACATTCC MIMAT0009214
8 bta-miR-133a 1.68E-06 11.63 3.54 up 12.57 3.65 CAGCTGGTTGAAGGGGAC MIMAT0009225
9 bta-miR-206 1.07E-05 11.60 3.54 up 13.36 3.74 CCACACACTTCCTTAC MIMAT0009260
10 bta-miR-133b 5.70E-06 11.53 3.53 up 12.12 3.60 TAGCTGGTTGAAGGGGACC MIMAT0009226
11 bta-miR-542-5p 2.59E-02 8.77 3.13 up 25.04 4.65 CTCGTGACATGATGATC MIMAT0013594
12 bta-miR-128 2.59E-02 4.51 2.17 up 4.78 2.26 AAAGAGACCGGTTCACTGT MIMAT0003541
13 bta-miR-660 5.18E-04 2.49 1.32 up 2.26 1.18 CAGCTCCGATATGCAA MIMAT0004344
14 bta-miR-378b 2.00E-03 2.42 1.28 up 2.38 1.25 GCCTTCTGACTCCAAG MIMAT0025535
15 bta-miR-378c 4.33E-03 2.25 1.17 up 2.18 1.13 ACTTCTGACTCCAAGTC MIMAT0025551
16 bta-miR-30a-5p 6.14E-03 2.14 1.10 up 2.51 1.33 AGCTTCCAGTCGAGG MIMAT0003841
17 bta-miR-30f 1.45E-02 2.14 1.10 up 2.86 1.52 AGCTGAGAGTGTAGGGT MIMAT0009282
18 bta-miR-9 2.77E-02 −40.65 −5.35 down −16.45 −4.04 TCATACAGCTAGATAACCA MIMAT0009389
19 bta-miR-29b 2.08E-03 −18.13 −4.18 down −4.24 −2.08 AAACACTGATTTCAAATGGT MIMAT0003828
20 bta-miR-31 1.99E-03 −16.57 −4.05 down −213.81 −7.74 AGCTATGCCAGCATCTT MIMAT0003548
21 bta-miR-194 4.25E-02 −14.83 −3.89 down −2.55 −1.35 TCCACATGGAGTTGCT MIMAT0009254
22 bta-miR-145 3.22E-02 −3.38 −1.76 down −2.82 −1.5 AGGGATTCCTGGGAAAAC MIMAT0003542
23 bta-miR-222 4.74E-02 −2.53 −1.34 down −2.12 −1.08 ACCCAGTAGCCAG MIMAT0003530
  1. FC fold change, HF Holstein-Friesian, HER Hereford, LIM Limousine; FDR ≤ 0.05; FC ≥ 2.0; n = 4 (see statistical analysis)