Skip to main content

Advertisement

Table 1 Wild-type G4 motifs, their stability and conformation

From: Quadruplex DNA in long terminal repeats in maize LTR retrotransposons inhibits the expression of a reporter gene in yeast

Element family name G4 motif sequence Tm [°C] Molecularity Max delta epsilon Strand orientation
Huck 62.2 mono 265.5 paral + anti
CGGGGATATAGGGGGAACGCAGGGACGCGGGGC
Gyma 56.3 mono 265 paral
CTGGGCGGGGATGACGCGGGGTAGAGCAGGGCT
Tekay 61 mono 266 paral + anti
CAGGGGTTAGGGTTAGGGGATTTTGGGCC
Dagaf 55 mono 265 paral + anti
TTGGGTGACCTAGGGGTAGGGTTAAGGGAG
  1. G-runs that potentially participate in G4 formation are written in italics