Skip to main content

Table 1 Species specific primers used to amplify mtDNA of Anodonta cygnea using LR-PCR. FOR = forward, REV = reverse, Tm = melting temperature

From: The complete mitochondrial genome of the hermaphroditic freshwater mussel Anodonta cygnea (Bivalvia: Unionidae): in silico analyses of sex-specific ORFs across order Unionoida

Primer Name Sequence 5′ – 3′ Tm (°C) Target Gene
ACP3 short FOR CCAGCTAAAACAGGCAAAGC 63.7 cox1
ACP3 short REV CGGGGTCTTTTCGTCTACCT 64.2 rrnl
ACP3 long FOR CCTCGATGTTGGCTTAAGGA 64.0 rrnl
ACP3 long REV GGAGGTTATTGGGGGATGAT 63.6 cox1