Skip to main content

Table 2 Sequences of primers used for quantitative real-time PCR

From: Upregulation of genes encoding digestive enzymes and nutrient transporters in the digestive system of broiler chickens by dietary supplementation of fiber and inclusion of coarse particle size corn

Gene Gene full name Primer sequence (5′-3′) Exons spanning Ta size (bp) Reference Accession No.
ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 F-GTCAACCCGAGGGATGCTAA
R-ACTGCTACAATGGCACCCTG
15/16
N/A
60 179 This study NM_205521.1
AMY2A Pancreatic alpha 2A amylase F-CGGAGTGGATGTTAACGACTGG
R-ATGTTCGCAGACCCAGTCATTG
7/8
N/A
60 112 This study NM_001001473.2
APN Aminopeptidase N F-AATACGCGCTCGAGAAAACC
R-AGCGGGTACGCCGTGTT
N/A
N/A
60 70 [40] NM_204861.1
ASCT1 Alanine, serine, cysteine, and threonine transporter (SLC1A4) F-TTGGCCGGGAAGGAGAAG
R-AGACCATAGTTGCCTCATTGAATG
N/A
N/A
60 63 [41] XM_001232899.4
B0AT Solute carrier family 6, member 19 (SLC6A19) F-GTGTTTGGAACCCTAAATACGAGG
R-TAGCATAGACCCAGCCAGGA
12/13
N/A
60 72 This study XM_419056.5
bo,+AT Solute carrier family 7, member 9 (SLC7A9) F-CAGTAGTGAATTCTCTGAGTGTGAAGCT
R- GCAATGATTGCCACAACTACCA
N/A
N/A
60 88 [40] NM_001199133.1
CAT1 Cationic amino acid transporter-1 (SLC7A1) F-CAAGAGGAAAACTCCAGTAATTGCA
R- AAGTCGAAGAGGAAGGCCATAA
N/A
N/A
60 75 [40] XM_015277945.1
CAT2 Cationic amino acid transporter-2 (SLC7A2) F-TGCTCGCGTTCCCAAGA
R- GGCCCACAGTTCACCAACAG
N/A
N/A
60 67 [40] XM_015285435.1
CCK1R Cholecystokinin type 1 receptor F-CACTTACTTCATGGGTATCTCTGTG
R-GATGGCAACAAGGTTGAATGTAGA
N/A
N/A
60 55 [42] AB214534.1
CCK Cholecystokinin F-AGGTTCCACTGGGAGGTTCT
R-CGCCTGCTGTTCTTTAGGAG
N/A
N/A
60 152 This study XM_015281332.1
CELA1 Chymotrypsin-like elastase family, member 1 F-AGCGTAAGGAAATGGGGTGG
R-GTGGAGACCCCATGCAAGTC
N/A
N/A
60 75 This study XM_015300368.1
CELA2A Chymotrypsin like elastase family member 2A F-GAGGGGAAGATGCAAGACCAT
R-CCTTGCTCCTCAGCTTCTAGG
N/A
N/A
60 196 This study NM_001032390.2
EAAT3 Excitatory amino acid transporter 3 (SLC1A1) F-TGCTGCTTTGGATTCCAGTGT
R-AGCAATGACTGTAGTGCAGAAGTAATATATG
N/A
N/A
60 79 [43] XM_424930.5
GLUT1 Glucose transporter-1 (SLC2A1) F-TCCTCCTGATCAACCGCAAT
R-TGTGCCCCGGAGCTTCT
N/A
N/A
60 65 [43] NM_205209.1
GLUT2 Glucose transporter-2 (SLC2A2) F-TGATCGTGGCACTGATGGTT
R-CCACCAGGAAGACGGAGATA
N/A
8/9
60 171 This study NM_207178.1
LAT1 L type amino acid transporter-1 (SLC7A5) F-GATTGCAACGGGTGATGTGA
R- CCCCACACCCACTTTTGTTT
N/A
N/A
60 70 [40] KT876067.1
PGA5 Pepsinogen A F-TCCGTCTACCTGAGCAAGGAT
R- AAGCAGGCGACGTACTTGTT
6–7
N/A
60 167 This study NM_204878.1
PGC Pepsinogen C F-ATCGGGATTGAGGACTTCGC
R- TGAAGACCTGGTTGGGAACG
6–7
N/A
60 115 This study NM_204877.2
PepT1 Peptide transporter-1 (SLC15A1) F-TACGCATACTGTCACCATCA
R-TCCTGAGAACGGACTGTAAT
N/A
N/A
60 205 [44] AY029615.1
PepT2 Peptide transporter-2 (SLC15A2) F-TGACTGGGCATCGGAACAA
R-ACCCGTGTCACCATTTTAACCT
N/A
N/A
60 63 [41] NM_001319028.1
PNLIP Pancreatic lipase F-GCATCTGGGAAGGAACTAGGG
R- TGAACCACAAGCATAGCCCA
7/8
N/A
60 113 This study NM_001277382.1
rBAT Solute carrier family 3, member1 (SLC3A1) F-CCCGCCGTTCAACAAGAG
R- AATTAAATCCATCGACTCCTTTGC
N/A
N/A
60 70 [40] XM_426125.4
SI Sucrase isomaltase F-GCTTTAAGATGGGCAAGAGGAAG
R- CCACCACCAGGCAAAAGAGG
1/2
N/A
60 65 This study XM_015291762.1
y+LAT1 y+ L amino acid transporter-1 (SLC7A7) F-TACTGAGGCTGACTGGAGGAA
R- ACGACGTACAGCACAATATCTGG
N/A
1/2
62 227 This study XM_418326.5
y+LAT2 y+ L amino acid transporter-2 (SLC7A6) F-GCCCTGTCAGTAAATCAGACAAGA
R-TTCAGTTGCATTGTGTTTTGGTT
N/A
N/A
60 82 [40] NM_001005832.1
HPRT1 Hypoxanthine Phosphoribosyltransferase 1 F-ACTGGCTGCTTCTTGTG
R-GGTTGGGTTGTGCTGTT
N/A
N/A
63 245 [45] NM_204848.1
TBP TATA-Box binding protein F-TAGCCCGATGATGCCGTAT
R- GTTCCCTGTGTCGCTTGC
N/A
N/A
62 147 [46] NM_205103
D83127
  1. N/A means not applicable