Skip to main content

Table 2 Genes and primer sets for RT-qPCR

From: Transcriptome-wide identification of optimal reference genes for expression analysis of Pyropia yezoensis responses to abiotic stress

Gene name Gene ID Gene symbol Prime sequence (forward/reverse) Size(bp) RT-qPCR Efficiencya Errorb
Methionyl aminopeptidase TRINITY_DN10053_c0_g1_i1 MAP TGGGTAGGAAGTGGGGCT 200 1.946 0.0793
    CGTGGTAGGTCGGTAGGC    
AAA-type ATPase TRINITY_DN1508_c0_g1_i1 ATPase CGACGAGATTGACGCA 132 2.014 0.0744
   GTCGCCCCAATCACAA    
Cystathionine gamma-synthase, Rhodoplastic TRINITY_DN3362_c1_g1_i1 CGS1 CTACGGACACCAAGAAACG 106 1.947 0.121
    CTCGGTTGGCTGGGTAA    
polyphosphate kinase, partial TRINITY_DN8109_c0_g1_i1 PPK GTGTCTGGTCCACGCTC 160 1.98 0.101
    CACGAGGTGCTGACTGAG    
Disproportionating Enzyme type 2 TRINITY_DN10209_c0_g1_i1 DPE2 CACGGAAGGTAGGAAAGGA 204 1.992 0.0582
    AGGTGGGTGTTGGGGTT    
fumarate hydratase precursor TRINITY_DN7986_c2_g1_i1 FHP TAATGTGCGAAAAGGCGG 146 1.973 0.117
    CGTGAACAAGTCCCAGTCCT    
ubiquitin-conjugating enzyme TRINITY_DN9056_c0_g3_i1 UBC CGCTGACCGTTTCCAAG 112 1.99 0.0598
    CGACTGCGGTTGGACTT    
elongation factor TRINITY_DN9169_c0_g1_i2 EF TGCGAGTCAACCAGGAG 175 1.96 0.153
    GCCTCAAGAAACACCCTA    
translation initiation factor 4 A TRINITY_DN16387_c0_g1_i1 eif4A ATGGACCAGAAGGACCG 139 1.951 0.144
    TCGTGGGCAGGTCATAG    
  1. a The RT-qPCR amplification efficiency for each primer were determined by LightCycle®480 gene scanning software (version 1.5)
  2. b The Error value of amplification efficiency for each primer were determined by LightCycle®480 gene scanning software (version 1.5) and an acceptable vaule should be< 0.2