Skip to main content

Table 3 Genes stimulated or inhibited by dehydration within couch grass rhizomes selected for qRT-PCR analysis, sequences of the primers and amplification efficiencies

From: The dehydration stress of couch grass is associated with its lipid metabolism, the induction of transporters and the re-programming of development coordinated by ABA

IDa AGIb Namec Primer sequence Efficiency (%)d
Contig15047_at AT5G20730.2 NPH4_F atcctatcccctcaagaagtgcaaa 93
NPH4_R tggtcgtaacgaggcttccaagtat
Contig1223_at AT3G53420.2 PIP_F agtacgtcctgagggcgagtg 92
PIP_R cacgatccgagccatatcacactgat
Contig14720_s_at AT1G34260.1 PI3PK_F gagtttgtacttggcatcatcgact 95
PI3PK_R aaccgttaggaaatacttggccatg
HVSMEf0022D18r2_s_at AT3G22600.1 LTPG5_F gatcgggttggcgcgcataca 92
LTPG5_R atgcatgtcacggtacaacaaatgga
Contig10474_at AT1G80950.1 PLGAC_F gttgctctttcctgagggcac 108
PLGAC_R aaaatgactggttgtactggtgctc
Contig3810_at AT1G09350.1 WSI76_F tacgtgcaagcacacggttgg 97
WSI76_R acgtttcagccatgcatacgtgtacg
Contig14329_at AT1G04870.2 PRMT10_F ttgatgactccatctccgagagtaa 94
PRMT10_R atccatatccataagccggtgattc
Contig10182_at AT1G15520.1 ABC_F tcagccctattgcatggacactcaa 94
ABC_R gctactacccacaggaagtcgtgat
HT11N18r_s_at AT1G78390.1 NCED_F cttattaggcataggagatccccgg 94
NCED_R tgaagcaagtgtgagctaactgaat
Contig1708_s_at AT4G01985.1 DHN6_F agcacaagaccggtggcatcct 103
DHN6_R tccttgttaccgccggggagct
HW09B04u_at AT4G39670.1 GLTP_F cgttccatagctgggcaatccaga 108
GLTP_R acagagcaatcagtttcgttgagcc
Contig2406_at AT3G15670.1 WRAB1_F ttgcctttgatttgatggtactcgtgt 97
WRAB1_R gtgccacctttcgactgtcctc
Contig1718_s_at AT3G50980.1 DHN9_F aagacccgtgggatactgcatcgct 96
DHN9_R gtcgccatgtgctgctggttgtc
Contig9547_at AT2G26830.1 CEK4_F ggcactcattcaggcaagggta 95
CEK4_R ctcctcagtgaagaaaggaagcctt
HVSMEf0019H18r2_s_at AT4G01470.1 TIP1;3_F atccatgcgtcatcgccatga 96
TIP1;3_R tgactgactcacacacagtttaccc
Contig10112_at AT4G40060.1 HB16_F gatcctcggacagcgactcgagcg 99
HB16_R tgtccaggaacgacgcgccgaa
  1. aAffymetrix 22 K Barley1 GeneChip Genome Array probe set ID
  2. bA. thaliana locus identifier corresponding to individual IDs
  3. cF forward, R reverse, NPH4 Transcriptional factor B3 family protein, PIP plasma membrane intrinsic protein, aquaporin, PI3PK phosphatidylinositol-3P 5-kinase, LTPG5 glycosylphosphatidylinositol-anchored lipid transfer protein 5, PGLAC phospholipid/glycerol acyltransferase, WSI76 galactinol synthase, PRMT10 histone-arginine-N-methyltransferase, ABC ATP-binding cassette transporter, NCED 9-cis-epoxycarotenoid dioxygenase, DHN6 dehydrin DHN6, GLTP glycolipid transfer protein, WRAB1 ABA-inducible protein WRAB1, DHN9 dehydrin DHN9, CEK4 choline/ethanolamine kinase 4, TIP1;3 tonoplast intrinsic protein 1;3, HB16 homeobox protein 16
  4. dAmplification efficiency