Skip to main content

Table 1 Primers of qRT-PCR for validation of the selected DEGs

From: Transcriptome analysis of chrysanthemum (Dendranthema grandiflorum) in response to low temperature stress

Gene Name Description Primers
MEKK1 Mitogen-activated protein kinase kinase kinase F:CAATTCGCGGAACACCAATG
R:TTGAAACCGGGTCACTAACG
MYB-like Myb-like DNA-binding domain F:TGACCCTGATCCTGTGTTTG
R:GTCTACCTCTCCCAATTCATCTG
NAC90 NAC domain-containing protein F:TCCCACGACAAGAGAAACAAG
R:TGATCCCAATGGCTCGATTAC
FAD7 omega-3 fatty acid desaturase F:CTCCATTCCTTTCCACGGTAC
R:GTTATGGGTCCGCTTCAAATG
Hsp70 Heat shock 70 kDa protein F:CCAGCTCCACCTTGATACATC
R:GAAGATTGAGGATGCGATTGATG
LEA5 Late embryogenesis abundant protein F:AGAAAGTGTATCCGGAAGCG
R:CGTCAACTTGGCTTGTTTGG
LEA3 Late embryogenesis abundant protein F:GGGAAAGATAAGACAGGTGGG
R:GGAGTACCCATACCCAAAGC
P5CS pyrroline-5-carboxylate synthetase F:TTAGCAGGTCTTTGTGGGTG
R:GATGGGTGTTGAGAGGTAAAGG
ABF ABA responsive element binding factor F:CACCAAAGACTCCAATTCAACAG
R:CAGAGGGAAGAGGAAAGTGTTG
PP2C Protein phosphatase 2C F:TTGTCGCAGTTCTCATACTCC
R:TGATACGGCTTGTGGACTTG