Table 3 Oligonucleotide primers used in gene-specific qRT-PCR assays for six DEGs
From: Transcriptome sequencing and analysis during seed growth and development in Euryale ferox Salisb
Gene identifier | Gene description | Function | Forward primer (5′-3′) | Reverse primer (5′-3′) | Tm (°C) | Product (bp) |
|---|---|---|---|---|---|---|
c44497.graph_c0 | Pectinesterase | Starch and sucrose metabolism | CGCTGAAGTTTTGGGAGATG | CCGACCTCCATTAGAAAACG | 54.9 | 113 |
c50120.graph_c0 | Beta-glucosidase | Starch and sucrose metabolism | GAACCCTCTTGAGCCTACTTGG | TCCATCCACCGCACTGATAACC | 60.6 | 185 |
c17722.graph_c0 | Cytochrome P450 | Phenylpropanoid biosynthesis | TCTCGGTGATGAGTCCTCTGCT | GTTCCGCCATTGCCCATTCTAT | 60.6 | 157 |
c55946.graph_c2 | Phenylalanine ammonia-lyase | Phenylpropanoid biosynthesis | CTTCTCTGGCATTCGGTTCG | ACGATAGCGGCACCAAGTCC | 60.6 | 121 |
c41810.graph_c1 | 9-cis-epoxycarotenoid dioxygenase | Carotenoid biosynthesis | GTCATCCGAAAGCCTTACCTCC | GTGGAAGCAGAAGCAGTCAGGG | 60.6 | 293 |
c53300.graph_c0 | Phytoene synthase | Carotenoid biosynthesis | CCTGTTGACATCCAGCCATT | TCATCAGACCGACAGTTCCA | 55.6 | 129 |