Skip to main content

Table 1 Nucleotide sequence of primers used in this study

From: Acute Hepatopancreatic Necrosis Disease (AHPND) related microRNAs in Litopenaeus vannamei infected with AHPND-causing strain of Vibrio parahemolyticus

Primer name Primer sequence (5′ ➔ 3′)
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
mja-miR-6489-5p GGCACCGGACTGGCGCCCTT
dre-miR-107b AGCAGCATTGTACAGGGCTTT
bta-miR-4286 ACCCCACTCCTGGTACC
tch-miR-210 CTGTGCGTGTGACAGCGGCTGA
hsa-miR-211-5p TTCCCTTTGTCATCCTTCGCCT
sha-miR-10b TACCCTGTAGAACCGAAT
dpu-miR-193 TACTGGCCTGCTAAGTCCCAAA
bta-miR-22-5p AGTTCTTCAGTGGCAAGCTTTA
bmo-miR-9c-5p TCTTTGGTATCCTAGCTG
bmo-miR-278-5p CCGGACGAACTTCCCAGCTCGG
bbe-miR-210-5p CTGTGCGTGTGACAGCGGCTGA
age-miR-127 TCGGATCCGTCTGAGCTTGGCT